ID: 1112278724

View in Genome Browser
Species Human (GRCh38)
Location 13:98044411-98044433
Sequence GCTCCAGGTAGAGCACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112278724_1112278730 13 Left 1112278724 13:98044411-98044433 CCTGGGAGTGCTCTACCTGGAGC No data
Right 1112278730 13:98044447-98044469 TTCCTTTCTTTTCTAACCACAGG No data
1112278724_1112278732 26 Left 1112278724 13:98044411-98044433 CCTGGGAGTGCTCTACCTGGAGC No data
Right 1112278732 13:98044460-98044482 TAACCACAGGCTGTAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112278724 Original CRISPR GCTCCAGGTAGAGCACTCCC AGG (reversed) Intergenic
No off target data available for this crispr