ID: 1112281496

View in Genome Browser
Species Human (GRCh38)
Location 13:98066597-98066619
Sequence CATTCAAGATGAGATTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38252
Summary {0: 104, 1: 7793, 2: 11440, 3: 10277, 4: 8638}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112281496_1112281508 21 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281508 13:98066641-98066663 CATTGTGAGAGGGACCCGGTGGG No data
1112281496_1112281507 20 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281507 13:98066640-98066662 ACATTGTGAGAGGGACCCGGTGG No data
1112281496_1112281506 17 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281506 13:98066637-98066659 CACACATTGTGAGAGGGACCCGG No data
1112281496_1112281503 11 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281503 13:98066631-98066653 AATTCCCACACATTGTGAGAGGG No data
1112281496_1112281509 24 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281509 13:98066644-98066666 TGTGAGAGGGACCCGGTGGGAGG 0: 8
1: 273
2: 1765
3: 3706
4: 5553
1112281496_1112281502 10 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112281496 Original CRISPR CATTCAAGATGAGATTTGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr