ID: 1112281498

View in Genome Browser
Species Human (GRCh38)
Location 13:98066600-98066622
Sequence TACCATTCAAGATGAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35467
Summary {0: 77, 1: 7035, 2: 10594, 3: 9589, 4: 8172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112281498_1112281507 17 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281507 13:98066640-98066662 ACATTGTGAGAGGGACCCGGTGG No data
1112281498_1112281502 7 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data
1112281498_1112281503 8 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281503 13:98066631-98066653 AATTCCCACACATTGTGAGAGGG No data
1112281498_1112281508 18 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281508 13:98066641-98066663 CATTGTGAGAGGGACCCGGTGGG No data
1112281498_1112281506 14 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281506 13:98066637-98066659 CACACATTGTGAGAGGGACCCGG No data
1112281498_1112281509 21 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281509 13:98066644-98066666 TGTGAGAGGGACCCGGTGGGAGG 0: 8
1: 273
2: 1765
3: 3706
4: 5553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112281498 Original CRISPR TACCATTCAAGATGAGATTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr