ID: 1112281499

View in Genome Browser
Species Human (GRCh38)
Location 13:98066601-98066623
Sequence CTACCATTCAAGATGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29864
Summary {0: 46, 1: 4190, 2: 7375, 3: 9030, 4: 9223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112281499_1112281509 20 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281509 13:98066644-98066666 TGTGAGAGGGACCCGGTGGGAGG 0: 8
1: 273
2: 1765
3: 3706
4: 5553
1112281499_1112281508 17 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281508 13:98066641-98066663 CATTGTGAGAGGGACCCGGTGGG No data
1112281499_1112281503 7 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281503 13:98066631-98066653 AATTCCCACACATTGTGAGAGGG No data
1112281499_1112281502 6 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data
1112281499_1112281507 16 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281507 13:98066640-98066662 ACATTGTGAGAGGGACCCGGTGG No data
1112281499_1112281506 13 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281506 13:98066637-98066659 CACACATTGTGAGAGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112281499 Original CRISPR CTACCATTCAAGATGAGATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr