ID: 1112281502

View in Genome Browser
Species Human (GRCh38)
Location 13:98066630-98066652
Sequence TAATTCCCACACATTGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112281498_1112281502 7 Left 1112281498 13:98066600-98066622 CCCAAATCTCATCTTGAATGGTA 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data
1112281496_1112281502 10 Left 1112281496 13:98066597-98066619 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data
1112281499_1112281502 6 Left 1112281499 13:98066601-98066623 CCAAATCTCATCTTGAATGGTAG 0: 46
1: 4190
2: 7375
3: 9030
4: 9223
Right 1112281502 13:98066630-98066652 TAATTCCCACACATTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112281502 Original CRISPR TAATTCCCACACATTGTGAG AGG Intergenic
No off target data available for this crispr