ID: 1112294692

View in Genome Browser
Species Human (GRCh38)
Location 13:98176723-98176745
Sequence GGGCAACTCCTCCTCGGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112294692_1112294697 -7 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294697 13:98176739-98176761 GTTGCCCATGGACGTGTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 89
1112294692_1112294706 28 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294706 13:98176774-98176796 TCAGGTAGCTGTGGATTCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 170
1112294692_1112294704 19 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294704 13:98176765-98176787 TCAGGTACCTCAGGTAGCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 222
1112294692_1112294701 1 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294701 13:98176747-98176769 TGGACGTGTCCTTGGGCTTCAGG 0: 1
1: 0
2: 1
3: 9
4: 126
1112294692_1112294703 10 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294703 13:98176756-98176778 CCTTGGGCTTCAGGTACCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 196
1112294692_1112294698 -6 Left 1112294692 13:98176723-98176745 CCATCCCCGAGGAGGAGTTGCCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1112294698 13:98176740-98176762 TTGCCCATGGACGTGTCCTTGGG 0: 1
1: 0
2: 1
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112294692 Original CRISPR GGGCAACTCCTCCTCGGGGA TGG (reversed) Exonic
900522543 1:3112712-3112734 GGGCAGCTGCTCCCCGGTGAGGG + Intronic
902596797 1:17515147-17515169 GGGCAACTTGTCCTGGGGAAGGG + Intergenic
905097709 1:35488293-35488315 TGGAAACTCCTCCTGTGGGATGG + Intronic
906129039 1:43445045-43445067 GGGCAGCTCCTCCCCAGGGTAGG - Intronic
912508868 1:110174939-110174961 GGGCATCCAGTCCTCGGGGAAGG + Exonic
915146804 1:153800350-153800372 GGGCAGAGCCTCCTGGGGGAGGG - Intergenic
1063206513 10:3836992-3837014 GGGCGACACTTCCTCGGAGATGG + Intergenic
1064146433 10:12829823-12829845 GGGCCCCTCCTCCTGGGGAAGGG - Exonic
1067214367 10:44289283-44289305 GGGCAGCTCCCCCTAAGGGAAGG - Intergenic
1067474182 10:46555713-46555735 GGGCAAATCCTCCCCAGGGGAGG - Intergenic
1074466886 10:113691570-113691592 GGGCTCCTACTCCTAGGGGAAGG - Intronic
1076727395 10:132419965-132419987 GGGCAACTCCTCCGGGAGCAGGG + Intergenic
1076864579 10:133160553-133160575 GCTCACCTCGTCCTCGGGGAGGG - Exonic
1077172236 11:1172248-1172270 GGGGAGCTTTTCCTCGGGGAGGG + Intronic
1083655236 11:64226248-64226270 GGGCACTTCCGCTTCGGGGAAGG + Exonic
1083857582 11:65400770-65400792 GGGCTCCTCCTCCTCGGGGGAGG - Exonic
1084020134 11:66412298-66412320 GGGCAGCTGCTGCCCGGGGAAGG + Intergenic
1084516558 11:69640935-69640957 GGGCAACTCCGCCGCAGGGCAGG + Intergenic
1085238723 11:75034390-75034412 GGGCAAGTCCTCATCAGAGATGG - Intergenic
1085470230 11:76752939-76752961 GGGCAGCTCCTCCGCTGGGCCGG + Intergenic
1091498353 12:991453-991475 GGGCAACGCGCCCCCGGGGAGGG + Intronic
1091798284 12:3309537-3309559 GGGCATCTCCCCCTGGGGGAGGG - Intergenic
1091801312 12:3326414-3326436 AGGCAACTCCTCCCAGGGGAGGG - Intergenic
1099989615 12:89708752-89708774 GTGCAGCTGCACCTCGGGGATGG + Exonic
1104060862 12:125267153-125267175 GAGCAACTCCTACATGGGGATGG - Intronic
1104928879 12:132328122-132328144 GGGCGGCTGCTCCTCCGGGAAGG + Intronic
1108464428 13:50700543-50700565 GGGCAATACCTCCTCGAAGAGGG - Intronic
1112294692 13:98176723-98176745 GGGCAACTCCTCCTCGGGGATGG - Exonic
1114355796 14:21906800-21906822 GGGCAGCTGCTTCTCGGTGATGG - Intergenic
1116817953 14:49600091-49600113 GGGCACGTACTCCTCCGGGAAGG - Intronic
1122982946 14:105199748-105199770 GGCCAGCCCCTCCTCTGGGAAGG + Intergenic
1123015350 14:105371154-105371176 GGGCAGCTCCGCCACTGGGATGG + Intronic
1124170346 15:27367135-27367157 TGGAAACTCCACCTCTGGGAAGG - Intronic
1124708276 15:31983487-31983509 AAACAACTCCTCCTTGGGGAAGG + Intergenic
1128092991 15:64931538-64931560 GTGCAGCTCCTCCTCAGGGCTGG + Exonic
1128637514 15:69312639-69312661 GGGCAGCTGATCCTGGGGGACGG - Intronic
1132845746 16:2000088-2000110 GGGGAAGTCCTCCTCCTGGAAGG + Exonic
1133202007 16:4209446-4209468 GGGGTACTCTTCCTCGGAGAGGG - Intronic
1136445537 16:30315472-30315494 GCGAAACTCCATCTCGGGGAGGG + Intergenic
1137553484 16:49455871-49455893 GGGCAACTCCTCCCCCTGGTGGG - Intergenic
1137722802 16:50637762-50637784 TGGCAACTGCTCCTCTGGAATGG - Exonic
1138098194 16:54230175-54230197 GGGCATCTGCTGCTGGGGGAAGG + Intergenic
1138297597 16:55900202-55900224 GGGAAACTTCTCCTGGGGCAGGG - Intronic
1141908268 16:87041691-87041713 GGGCAAGGCCTCGTTGGGGAAGG + Intergenic
1142355767 16:89601062-89601084 GAGGAGCTCCTCCTCGGGGGTGG + Intergenic
1143639857 17:8189768-8189790 GGGCAAGCCCTCCTCCGGGAGGG - Exonic
1145775689 17:27526819-27526841 GGGCTCCTCCTCCGGGGGGAGGG + Intronic
1145915427 17:28571242-28571264 GGGCTTCTCCGCGTCGGGGATGG - Intronic
1146568916 17:33936553-33936575 GGGAAACTACTCCTCTGTGAGGG + Intronic
1147657550 17:42099194-42099216 GGGCAACTCTCCCCCCGGGAAGG + Intergenic
1147659768 17:42111309-42111331 GTGCTCCTCCTCCTCGGGGCTGG + Exonic
1149195655 17:54116951-54116973 GGGCACCATCACCTCGGGGATGG - Intergenic
1150251025 17:63704508-63704530 GGTCAGCTCCTCAGCGGGGATGG + Exonic
1151718251 17:75842489-75842511 GTGGGTCTCCTCCTCGGGGATGG + Exonic
1156486713 18:37471132-37471154 GGGCAAGTCCTGCTGGTGGAGGG - Intronic
1161338874 19:3729946-3729968 GGGCACCCCCTCCCCAGGGAGGG + Intronic
1162321452 19:9973293-9973315 GGGCAACTCATCCTCAGGTCAGG + Intronic
1162927593 19:13938067-13938089 GAGCATCCCCTCCTCGGGGAGGG + Intronic
1163826627 19:19527925-19527947 GGGCCACTGATCCTGGGGGATGG + Intronic
1165923725 19:39314452-39314474 CAGGAACTCCTCCTCGGGGATGG + Exonic
1166700149 19:44877669-44877691 GGGCCACACCCCCTCGGGGGAGG - Intronic
1167036560 19:46998491-46998513 GGGCCACACCCACTCGGGGATGG + Intronic
1167079759 19:47270989-47271011 GGGCAGCTCCTCCCTAGGGAGGG + Intronic
927486181 2:23489824-23489846 GGGCACCTCCTCCTTGGTGTGGG - Intronic
929966946 2:46543144-46543166 GGGCACGTACTCCTCCGGGAAGG - Exonic
936753485 2:115675845-115675867 GGGCTATTCGTCCTCAGGGAAGG - Intronic
938301017 2:130213371-130213393 GGGCACGTACTCCTCCGGGAAGG + Intergenic
938455701 2:131461096-131461118 GGGCAGGTACTCCTCCGGGAAGG - Intergenic
938595313 2:132782763-132782785 GGGGCACCCCTCCTCCGGGAAGG - Exonic
941746077 2:169088175-169088197 GGGCAATTCCTCCTCCGGCTAGG + Intronic
942080785 2:172397673-172397695 GGGCAAGTCCTCCCAAGGGAAGG - Intergenic
942084079 2:172428050-172428072 GGCCAACTACTCCCCGGGGCCGG - Intronic
944665270 2:201954219-201954241 GGGCAGCTGCTCCTCTGAGAAGG - Intergenic
947353539 2:229270966-229270988 GGGCACCTCCTCCTCCAGGCTGG + Intronic
1170383418 20:15787466-15787488 GGGGGACTCCTACTGGGGGATGG - Intronic
1171382221 20:24742535-24742557 GAGCGACTCCACCTCGGGGCAGG - Intergenic
1171410091 20:24940635-24940657 GGGCTACTCCCCCACTGGGAAGG - Intergenic
1171966747 20:31536349-31536371 GCGAAACTCCATCTCGGGGAGGG + Intronic
1173279683 20:41617854-41617876 GAGCAACTTCTCCGCGGGGGCGG + Intronic
1175392077 20:58633830-58633852 GGGCTGCTCCTCCTTGGGAAGGG - Intergenic
1175733505 20:61370165-61370187 GGGCCACCCACCCTCGGGGAAGG - Intronic
1180243447 21:46528188-46528210 GGGGAACTTCTCTTTGGGGATGG + Intronic
1180872820 22:19156588-19156610 GAGCAACTCCTCCAAGGCGAAGG - Intergenic
1182114757 22:27749802-27749824 GGGCAACCCCACCCCTGGGAGGG - Exonic
1184173580 22:42773231-42773253 GAGCAGCCCCTCCTCTGGGAGGG + Intergenic
1185032748 22:48453266-48453288 GGACAACTCTTCCTAGAGGATGG + Intergenic
950319854 3:12041228-12041250 GGACAGCTCTTCCTCTGGGAAGG - Intronic
951671572 3:25189444-25189466 GGGCCCCTGCTCCTAGGGGAGGG - Intronic
954194608 3:48989293-48989315 CTGCAAGTCCACCTCGGGGAGGG + Intergenic
954629317 3:52039641-52039663 GGGCAATGCCTCCTTGGGGAGGG - Intergenic
954696064 3:52427193-52427215 ATGCAACTCCTCCTTGAGGATGG + Intergenic
954712757 3:52513150-52513172 GGCCAGCTCCTCCTCGAAGAGGG - Exonic
954773145 3:52991957-52991979 GACAATCTCCTCCTCGGGGATGG - Intronic
955414502 3:58679985-58680007 GGGCAAACCCTCCTCGGGCATGG + Intergenic
955522791 3:59791403-59791425 AGGCAACCTCTCCTCAGGGAAGG - Intronic
960036933 3:113111278-113111300 GGCCAACACCTCCTCTGGGGAGG + Intergenic
963105685 3:141645227-141645249 GGGCCACTCCTCCCTGGGGCCGG - Intergenic
968311783 3:197689573-197689595 GGATAACTCCTCCTCAGGCAGGG + Intronic
968549911 4:1216835-1216857 GGCCGGCTCCTCCTCGGGGAAGG + Intronic
972530325 4:39955689-39955711 GGGGAAGTCTTCCTGGGGGACGG + Intronic
992889553 5:81191365-81191387 GTGCATCTTCTCCTTGGGGAAGG + Intronic
999135527 5:149316274-149316296 GGGAACCTCCTCCTCGGTGGAGG - Exonic
1001052393 5:168423757-168423779 GGCCACCTCATCCTCGTGGATGG - Exonic
1001255722 5:170182180-170182202 GGGCCACCCCTCCTCAGGAATGG + Intergenic
1001283292 5:170403641-170403663 GGCCAAGTGCTCCTCTGGGATGG + Intronic
1002103489 5:176868773-176868795 GAGCCACTCCACCTAGGGGAGGG - Exonic
1003115821 6:3283418-3283440 GTGAAACTCCATCTCGGGGAGGG + Intronic
1004744133 6:18492997-18493019 GGGCTGCTCCTCTTTGGGGATGG + Intergenic
1013414429 6:109912352-109912374 GGGCAACTAAGCCTGGGGGAAGG + Intergenic
1013606538 6:111754334-111754356 GGGCACCTCTCCCACGGGGAAGG + Intronic
1013995649 6:116304698-116304720 GGGCAGCTCCTCCTCTGTGCTGG - Intronic
1015682173 6:135820484-135820506 GGGCAGCTCCTCCCAGGAGAGGG + Intergenic
1018078158 6:160234468-160234490 GGGCAGCTCCTCCTGTGGCAGGG - Intronic
1018138268 6:160800003-160800025 GGGCAACTCCATCTTGAGGAGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019552051 7:1608101-1608123 GGGCTACACCTCTTGGGGGAAGG - Intergenic
1019734426 7:2643872-2643894 GGGAAACTCCTCCTGGGGTGAGG - Intronic
1021807612 7:24372870-24372892 GAGCAACACCTTCTCAGGGAAGG - Intergenic
1026443238 7:70461759-70461781 AGGCAACTCCTCACCTGGGAAGG - Intronic
1029195290 7:98801630-98801652 GAGCTACCCCTCCTCGGAGAAGG - Intergenic
1029515399 7:101020284-101020306 AGGCAGCTCTCCCTCGGGGATGG - Intronic
1029545580 7:101208802-101208824 CTGCACCTCCTCCTCTGGGAAGG + Intronic
1034195132 7:149240299-149240321 GGGCTGCTTCTCCTTGGGGACGG + Intronic
1036671628 8:10792334-10792356 GGACAACACCTCCTCCAGGAGGG + Intronic
1044224508 8:89704057-89704079 GGGCTCCTACTCCTAGGGGAAGG - Intergenic
1046645761 8:116783774-116783796 GGGCAACTGCCCATCTGGGAGGG - Intronic
1049268882 8:141683811-141683833 GGGAAGCTGCTCCTCTGGGAAGG - Intergenic
1049807008 8:144545693-144545715 GCGCAAGCCCTCCTCGGAGACGG - Exonic
1049981176 9:905178-905200 GGGCAACCCATCCTGGGGGGAGG - Intronic
1051211262 9:14747040-14747062 GGGCAACTGGTCCTTTGGGAAGG + Exonic
1060480654 9:124015158-124015180 GGGCATCTCGGCCTCGGAGATGG + Exonic
1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG + Intronic
1061864557 9:133485647-133485669 GGGCAGGACCTCCTCGGGGAAGG - Intergenic
1062621019 9:137422762-137422784 GAGCGCCTCCTCCTCGGCGAGGG + Intronic
1062623702 9:137433785-137433807 CAGCGACTCCTCCTCGGGGATGG - Exonic
1186345183 X:8684662-8684684 CAGCAACTTTTCCTCGGGGAAGG - Intronic
1187526170 X:20057028-20057050 GGGCAGCTTCTCCCCAGGGAGGG - Intronic
1191846510 X:65551297-65551319 GGGCTCCTCCTCCTCAGGGGAGG + Intergenic
1192189885 X:68984292-68984314 AGGGAGCTCCTCCTAGGGGACGG - Intergenic
1196842425 X:119871082-119871104 GGGCAATGCCTCTTCCGGGATGG - Exonic
1197723762 X:129762098-129762120 GGGCTAGTCCTGCTCTGGGATGG - Intronic
1200216513 X:154370509-154370531 GGCCTCCTCCTCCTCGGGGACGG + Intronic
1202050642 Y:20777034-20777056 GGGCACCTCAGCCTCGCGGAAGG - Intronic