ID: 1112296412

View in Genome Browser
Species Human (GRCh38)
Location 13:98191096-98191118
Sequence GGAGGCATTAAGGGAACTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112296402_1112296412 9 Left 1112296402 13:98191064-98191086 CCAGGACCTTTCCTCTCCGGCCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 146
1112296404_1112296412 -2 Left 1112296404 13:98191075-98191097 CCTCTCCGGCCCGACACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 146
1112296407_1112296412 -7 Left 1112296407 13:98191080-98191102 CCGGCCCGACACTGCTGGAGGCA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 146
1112296403_1112296412 3 Left 1112296403 13:98191070-98191092 CCTTTCCTCTCCGGCCCGACACT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112296412 Original CRISPR GGAGGCATTAAGGGAACTCC CGG Intronic
900906739 1:5564618-5564640 GGAGACAGGGAGGGAACTCCCGG + Intergenic
901034408 1:6327637-6327659 GTAGGCATTAAAGCAATTCCAGG - Intronic
901760386 1:11467382-11467404 GGAGGCATGACTTGAACTCCTGG - Intergenic
903201344 1:21742237-21742259 GGAACCATAAAGAGAACTCCTGG + Intronic
903655698 1:24947751-24947773 AGAAGGATTCAGGGAACTCCAGG - Intronic
904158108 1:28501739-28501761 GGAGGCATGAAGGGAAAACCAGG + Intergenic
904439520 1:30521374-30521396 GGAGTGATCAAGGGGACTCCAGG - Intergenic
906723701 1:48028065-48028087 AAAGGCACTAAGGGAAATCCAGG - Intergenic
907074571 1:51566615-51566637 GGTGGCATTCAGGGAACTGAGGG - Intergenic
907462863 1:54615631-54615653 GGAGGCATTATGGTGACGCCTGG + Intronic
914377134 1:147081095-147081117 ATAGGCATTCAGGGAACACCAGG - Intergenic
920025269 1:202989343-202989365 GGAGGAAGAAAGGGGACTCCAGG - Intergenic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
923479847 1:234373725-234373747 GGGGACAGTAAGGGACCTCCCGG - Exonic
1063191179 10:3696373-3696395 GGACGCATCATGGAAACTCCGGG - Intergenic
1066397033 10:35036086-35036108 GGAGGCATGAAGGGGACTCCTGG - Intronic
1069851259 10:71406485-71406507 GGAGGCATTCAGGTGGCTCCAGG + Intronic
1075734197 10:124654043-124654065 AGAGCCATTAAGGGATCTGCTGG + Intronic
1076245649 10:128945469-128945491 GGAGGCATTGAGGGTGGTCCCGG - Intergenic
1076853409 10:133103903-133103925 GCAGGCATTCAGGGAGCCCCAGG - Intronic
1077675648 11:4191339-4191361 GGAGGCACTCAGGAACCTCCTGG - Intergenic
1083069049 11:59957672-59957694 ACAGGAATTAATGGAACTCCAGG - Intergenic
1083125998 11:60566119-60566141 AGAGGCCTTAAGATAACTCCTGG - Intergenic
1083956009 11:65983225-65983247 GGAGGAATTAAGGGAAATACAGG + Intergenic
1084266909 11:68009881-68009903 GGAGGCATTGAGGGAAGGCTGGG + Intronic
1084557624 11:69884291-69884313 GGAGGCACTAAAAGAATTCCTGG + Intergenic
1086692727 11:89807099-89807121 GGAACCATTAAAAGAACTCCAGG - Exonic
1086713076 11:90032560-90032582 GGAACCATTAAAAGAACTCCAGG + Exonic
1087672323 11:101122527-101122549 GAAGGCATTAAGTCAATTCCTGG + Intronic
1088548029 11:110981334-110981356 GGAGGAAGAAAGGGCACTCCAGG + Intergenic
1089406694 11:118203387-118203409 GGGAGCATTGAGGGACCTCCTGG - Intronic
1093130412 12:15385252-15385274 GAAGACAATAAGGGAAGTCCAGG + Intronic
1097952461 12:65447084-65447106 TGAGGTATTCAGGGAACGCCAGG + Intronic
1099123494 12:78722571-78722593 GGAGGTGCTAAGGGAACTCAGGG - Intergenic
1101487181 12:105176739-105176761 GGAGGTATTATCTGAACTCCTGG + Intronic
1105443335 13:20433048-20433070 GGAGGAATTAAGGAAATACCAGG - Intronic
1107214258 13:37897278-37897300 GCAGGCATTAGGGGATCTTCAGG + Intergenic
1110089737 13:71431125-71431147 GGAGGCAATAAGGAAACCCAGGG - Intergenic
1112296412 13:98191096-98191118 GGAGGCATTAAGGGAACTCCCGG + Intronic
1112552482 13:100434577-100434599 GGAGGCATTAAGTGTTCTGCAGG - Intronic
1112944220 13:104906484-104906506 GGAAACATTGAGGAAACTCCAGG - Intergenic
1113787447 13:113010069-113010091 GGAGGCAGCAAGGCAGCTCCTGG - Intronic
1114193438 14:20457977-20457999 GGAGGAATTAAGGGAAATACAGG + Exonic
1115309184 14:31962355-31962377 CCAGGAATTAAGGGAACTTCCGG + Intergenic
1116068936 14:40018228-40018250 GAAGGCATTAAGGGAAGACAGGG - Intergenic
1117988096 14:61408364-61408386 GGGGGCATTCAGGGAACTGTAGG - Intronic
1123040716 14:105489186-105489208 GGGGGAGTTATGGGAACTCCTGG + Intronic
1126903533 15:53339440-53339462 GTAGGCATGAAGGGAACTAATGG + Intergenic
1127605989 15:60589348-60589370 GGAGGCTTAAAGGGAATTTCTGG - Intronic
1127882569 15:63171012-63171034 GGTGCCATTAAGGGAACTATGGG + Intergenic
1129578146 15:76776132-76776154 GGAGGCAGTAAGGAAACCCATGG - Intronic
1129766924 15:78175559-78175581 ACAGGCCTTAAGGGAACTGCAGG + Intronic
1132994659 16:2816917-2816939 CCAGGCTTTAAGGGGACTCCTGG + Intergenic
1139599067 16:67975831-67975853 GGAGGCATTTGAGGACCTCCAGG + Exonic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140646538 16:77037822-77037844 GGAGGCCTTAAGTGAAACCCAGG - Intergenic
1143903079 17:10189202-10189224 GGAGGGAGTAAGGGAACCTCAGG - Intronic
1144932975 17:18874960-18874982 GTAGGCATTGAGGGCACCCCTGG + Intronic
1147924423 17:43938036-43938058 GGACGCCTTAAGGGACATCCTGG - Intergenic
1151819660 17:76490681-76490703 GCAGGCCTGAAGGGACCTCCAGG - Intronic
1153819894 18:8824216-8824238 AGAGGCATTCAGCGAACTCATGG + Intronic
1155155245 18:23152003-23152025 GAAGGCATTGAGGAGACTCCGGG + Intronic
1155635656 18:27952246-27952268 TGAGGAATTAAGGGAGCTCAAGG + Exonic
1156122668 18:33863878-33863900 GGAGGCTGTATGGGAACACCTGG - Intronic
1157221381 18:45830455-45830477 GGAGGCATGAAGGGAGCTATGGG + Intronic
1158799730 18:60892225-60892247 GGAGCCACTGAGGGAAGTCCAGG + Intergenic
1158840238 18:61378008-61378030 GGGGACATCAAAGGAACTCCTGG - Intronic
1161184401 19:2906842-2906864 GGAGGCATCAGGGCAGCTCCGGG + Intronic
1164781471 19:30896883-30896905 GGAGGCACACAGGGATCTCCAGG + Intergenic
1165061746 19:33208165-33208187 TGAGGCCTGCAGGGAACTCCAGG - Exonic
1166149048 19:40857638-40857660 GGCAGCATTAAGGGAAATCCTGG - Intronic
1167692206 19:50992707-50992729 GGAGACATTAAAGTATCTCCTGG + Intergenic
1168083823 19:54030172-54030194 ACAGGCATCAAGGGAACTGCAGG + Intergenic
926695358 2:15766855-15766877 GGAGGCATTTGGGGACCTCGAGG + Intergenic
926738735 2:16093889-16093911 AAAGGCATCAAGGGACCTCCGGG + Intergenic
935924345 2:108051320-108051342 GGAGGTAATAAGGGAAGTTCTGG + Intergenic
937280045 2:120711446-120711468 AAGGGCACTAAGGGAACTCCTGG + Intergenic
938143902 2:128818547-128818569 GGAGGCCTTAATGGATTTCCTGG + Intergenic
940538330 2:154976352-154976374 GGTGGTATAAAGGGAACTTCTGG + Intergenic
940678361 2:156752749-156752771 GGAGGCATCAAGGGGTCACCTGG + Intergenic
942922274 2:181390204-181390226 TGAGGCATCAAGGTAACTCTAGG + Intergenic
945393232 2:209290555-209290577 TGAGGCATTGAGGGAAAACCAGG - Intergenic
945490102 2:210444486-210444508 GGAGTCTTTAAGGGAACTGCAGG + Intronic
947463934 2:230325063-230325085 GAAGGAAATAATGGAACTCCTGG - Intergenic
947472849 2:230414209-230414231 GAAGGAAATAATGGAACTCCTGG - Intergenic
1169110940 20:3033314-3033336 GGAGGAAGGAAGGTAACTCCCGG - Intronic
1169617337 20:7463676-7463698 GGAGGCACAAAGGGAACTGCAGG + Intergenic
1170552845 20:17491840-17491862 GGAGACATAAAGGGGACTGCAGG - Intergenic
1173160958 20:40652505-40652527 TGTGGCTTGAAGGGAACTCCCGG + Intergenic
1176049625 20:63111044-63111066 GGAGGCAATAAGGAAACCCAGGG + Intergenic
1176886668 21:14264679-14264701 GTAGGCATTATGGGAAGTGCTGG - Intergenic
1178636303 21:34307134-34307156 AGAGGGGCTAAGGGAACTCCAGG + Intergenic
1179719331 21:43306460-43306482 GGAGGCATAAAGGGACCCCCAGG + Intergenic
1181461834 22:23090269-23090291 GGAGACGATCAGGGAACTCCAGG - Intronic
1185160902 22:49229258-49229280 AGAGGCCTGAAGGGAACTCCAGG - Intergenic
950118796 3:10468228-10468250 GCATCCACTAAGGGAACTCCTGG + Intronic
950522652 3:13505839-13505861 GGGGACATTCAGGGACCTCCAGG + Exonic
954256680 3:49412156-49412178 TGGGGCATCACGGGAACTCCGGG + Exonic
957846308 3:85741111-85741133 GAAGGAATTAATAGAACTCCAGG + Intronic
966135409 3:176692653-176692675 GGAAGCATTAAGTGAACCCCAGG + Intergenic
972324388 4:38001372-38001394 GGTGGGATTCAGGGAGCTCCTGG - Intronic
972482162 4:39507272-39507294 GGAAGCATTAAGTGAGCTCTGGG - Intronic
976365468 4:84228385-84228407 GGAGGCAATAAGGGAAGTGAGGG + Intergenic
979775374 4:124583062-124583084 GGAGGCAGTGAGTGAGCTCCGGG + Intergenic
986397860 5:7347985-7348007 GGAGGCAGCCAGAGAACTCCTGG - Intergenic
986608689 5:9546336-9546358 GGAGGCTGGAATGGAACTCCTGG - Intergenic
989444416 5:41510696-41510718 GGAGGCACTAAGGGAGCACGGGG - Intergenic
990156889 5:52887818-52887840 GGAGGCATTCACGGAAGCCCGGG + Exonic
990177453 5:53123500-53123522 GGAGGCATCAAGAGAACTTTTGG + Intergenic
990673406 5:58157905-58157927 GGAGGCATTAAGGATACACCTGG - Intergenic
991771245 5:70042992-70043014 ACAGGCATTAAGGGCACACCAGG - Exonic
991850537 5:70918409-70918431 ACAGGCATTAAGGGCACACCAGG - Exonic
992552498 5:77872181-77872203 AGAGGCATTAAGGAGGCTCCTGG - Intergenic
994188231 5:96838991-96839013 TGAGGGATTGTGGGAACTCCTGG - Intronic
994463690 5:100099263-100099285 GGAGGAATTTAGGGTAGTCCTGG + Intergenic
994727703 5:103455854-103455876 GGAAAGATTAAGGGAATTCCTGG - Intergenic
995539307 5:113169042-113169064 GGAGGCATTCAGGGTGCTCTGGG - Intronic
998000362 5:138620357-138620379 GGAGGCAGTGCGGGAAGTCCTGG + Intronic
998835957 5:146203402-146203424 GGAGAGCTTAAGTGAACTCCTGG - Intergenic
998981258 5:147705248-147705270 GGAGCCAGGAAGGGAATTCCAGG + Intronic
999588769 5:153120573-153120595 GAAGGCATAAAGAGAGCTCCAGG - Intergenic
999888724 5:155953175-155953197 GGAAGTAAAAAGGGAACTCCAGG - Intronic
1000581988 5:163046484-163046506 GGAGGCATGAAGGGAAAGCAGGG - Intergenic
1000726153 5:164773328-164773350 GGAGGCTTTCAGGGAGATCCTGG + Intergenic
1001197298 5:169685273-169685295 GGAGGAAGTGAGGGAACTTCTGG + Intronic
1002303595 5:178271069-178271091 GGGGGCACTCAGGGACCTCCAGG + Intronic
1002770945 6:290742-290764 AGAGGCAGAAAGGGCACTCCGGG + Intergenic
1007746737 6:44047774-44047796 GGAGGCAGTCAGGGACTTCCTGG - Intergenic
1010596910 6:77775101-77775123 GACGGCATTTAGGGACCTCCTGG + Intronic
1013435506 6:110101695-110101717 GGAGGCATTAATGGAACATGGGG + Exonic
1018593428 6:165452868-165452890 GGAAGCATCAAGGGAAATTCTGG + Intronic
1023411420 7:39892463-39892485 GGAGGCAAAAGGGGAATTCCTGG + Intergenic
1024291569 7:47807992-47808014 GGAGGCACTGGGGGAATTCCAGG + Intronic
1029962252 7:104700298-104700320 GGAGACGTTAAGGAAACTTCAGG - Intronic
1033301778 7:140192575-140192597 GCAGGGCTTAAGGTAACTCCAGG + Intergenic
1035645058 8:1212366-1212388 TGGAGCATTAAGAGAACTCCAGG + Intergenic
1035796975 8:2366737-2366759 GGAGGCAGCAAGGGACATCCGGG + Intergenic
1037067386 8:14598870-14598892 GCAATCATTTAGGGAACTCCAGG + Intronic
1037325659 8:17687404-17687426 GCAGGATTTAAGGGAACCCCTGG - Intronic
1039905391 8:41782384-41782406 GGTGACATTAAGGGACCTGCAGG - Intronic
1040310617 8:46234908-46234930 GGAAGCATTCAGGGCTCTCCTGG + Intergenic
1041340488 8:56840695-56840717 GGAAGCAATAAGGAAACTCTAGG + Intergenic
1044486024 8:92755717-92755739 GGAGGCAAGAAGGGAAGTCAGGG + Intergenic
1045109887 8:98930232-98930254 GGAGGCCTACTGGGAACTCCAGG + Intronic
1046731776 8:117733795-117733817 GTAGGCATTGAGGCAAGTCCAGG + Intergenic
1047342972 8:124000553-124000575 AGAGACATTAAGTGAACTCTGGG - Intronic
1056141694 9:83687157-83687179 GGAAGCATAAAGGGAAGTCAGGG + Intronic
1056287790 9:85108519-85108541 GGAGGCATCAAGGAAACCCAGGG + Intergenic
1060222016 9:121769260-121769282 GGAGGCATGAAGGGCCTTCCAGG - Intronic
1186994148 X:15101880-15101902 GGAGGCATGAAGGAGCCTCCTGG - Intergenic
1188249678 X:27876993-27877015 GGAGGCAATAAGGAAACCCAGGG + Intergenic
1192211196 X:69129017-69129039 GGAGGCATGCTGGGGACTCCCGG + Intergenic
1194160081 X:90438498-90438520 GGAGGCACTAATGGCCCTCCTGG - Intergenic
1198526728 X:137508894-137508916 GGAGGCATGAAGTGAACCTCAGG - Intergenic
1198546843 X:137701498-137701520 GGAGGTAAAAAGGGAATTCCAGG + Intergenic
1199860862 X:151799551-151799573 GGAGGTCCTAAGGGACCTCCAGG - Intergenic
1200506376 Y:4015449-4015471 GGAGGCACTAATGGCCCTCCTGG - Intergenic
1200959155 Y:8981414-8981436 GGAGGGAAGAAGGGATCTCCGGG - Intergenic