ID: 1112300123

View in Genome Browser
Species Human (GRCh38)
Location 13:98222597-98222619
Sequence CTGTGACAGGTGCCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112300116_1112300123 24 Left 1112300116 13:98222550-98222572 CCATAAAGAGCCGTTAGGATAAT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 263
1112300117_1112300123 14 Left 1112300117 13:98222560-98222582 CCGTTAGGATAATACAACATGTT 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112300123 Original CRISPR CTGTGACAGGTGCCAGTGGA GGG Intronic
900280373 1:1863432-1863454 CTGTGGCTGCTGCCACTGGAGGG + Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
901207985 1:7508239-7508261 CTGTGACAGGGGTCTGTGGAGGG - Intronic
901972034 1:12915667-12915689 CTGGGGCAGATGCCAGAGGAAGG - Intronic
901974437 1:12932970-12932992 CTGGGACAGGTCCCAGTGCAGGG - Intronic
902010735 1:13268797-13268819 CTGGGACAGGTCCCAGTGCAGGG + Intergenic
902013145 1:13286095-13286117 CTGGGGCAGATGCCAGAGGAAGG + Intergenic
904952903 1:34258660-34258682 CTGTGTTAGGAGCCAGTGCAGGG + Intergenic
904971449 1:34422207-34422229 CTGTTCCAGGTTCCAGTGGAAGG + Intergenic
905513484 1:38542998-38543020 TTGTGCCATGTGCCTGTGGAAGG + Intergenic
907270055 1:53285772-53285794 CTGTGACAGATGCCCCCGGAGGG + Intronic
908444272 1:64187054-64187076 CTCAGACAGGCTCCAGTGGAAGG + Intergenic
911404327 1:97417831-97417853 GTGTTACTGGTGTCAGTGGATGG - Intronic
913146131 1:115992083-115992105 CTCTGCCAGGTCCCAGTGGTAGG - Exonic
915253198 1:154605259-154605281 TTGTGATAGGTGGCTGTGGAGGG - Intronic
917174271 1:172214846-172214868 CTTTTACAGCTGCCAGTGGAGGG + Intronic
917192045 1:172428358-172428380 CTGAGATAGGAGCCATTGGAGGG - Intronic
920679006 1:208058714-208058736 CTGTGAAAGGAGCCTGGGGAGGG - Intronic
921081096 1:211738863-211738885 CTGTGGCAGGAGCCCCTGGAAGG + Intergenic
921219555 1:212963437-212963459 CAGTGACAGGTGCCAGGATATGG + Intronic
923643468 1:235790864-235790886 CTGTGACAGGAACTAGGGGAGGG + Intronic
923764805 1:236883219-236883241 CTGTGATATGTCCCAGTGGTTGG + Intronic
923804427 1:237243131-237243153 CTGTGACCGGGGTCAGGGGAGGG + Intronic
924274364 1:242370492-242370514 CTGAGCCAGGGGCCAGGGGAGGG + Intronic
1063347658 10:5326550-5326572 CTGTGCCAGGTGGCAATGGTGGG - Intergenic
1065164169 10:22957405-22957427 CTGTGCGAGGGGTCAGTGGAAGG + Intronic
1065339745 10:24693711-24693733 GTGTGGCAGGAGCCAGTGAATGG - Intronic
1065921728 10:30399041-30399063 CCGTGACACCTGCCCGTGGAGGG + Intergenic
1069583171 10:69578744-69578766 CTGGGACAGGGGCCGCTGGACGG + Intergenic
1072442805 10:95471764-95471786 CAGTGACAGGAGGAAGTGGAAGG + Intronic
1073332231 10:102677821-102677843 CTGTTACAGATGCAAGGGGAAGG - Intronic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1075282027 10:121147411-121147433 CTGGGACAGATCCCAGAGGAAGG - Intergenic
1075674929 10:124289780-124289802 CTGTGACCGCTGCCAGTGTCCGG + Intergenic
1076258941 10:129050606-129050628 CGGTAACAGCAGCCAGTGGAGGG - Intergenic
1076659419 10:132045418-132045440 CTGTGCCAGGTGCGGGTAGAGGG - Intergenic
1077284866 11:1761115-1761137 CAATGACAGGGGCCAGTGGCAGG + Intronic
1077304951 11:1864829-1864851 CTGTGCCAGGTGCCAGAGGGAGG + Intronic
1077838319 11:5944935-5944957 CTGTGGCTGCTGTCAGTGGAGGG - Intergenic
1079144618 11:17839692-17839714 CTGTGGCATGTGCGCGTGGATGG - Intronic
1080072117 11:28101740-28101762 CTGTGACAAGTGCCATTATAGGG + Intronic
1080101321 11:28463048-28463070 CTGAGACAGGTGTTAGAGGAGGG + Intergenic
1081363372 11:42206109-42206131 ATCTGGCAGGTGCCAGAGGAAGG + Intergenic
1081576074 11:44319258-44319280 CTATGACAGGTGCTAGGGCAGGG - Intergenic
1082634000 11:55574591-55574613 CTCTAACAGGTGCTAGTGAATGG - Intergenic
1084393914 11:68896589-68896611 CTTTGCCAGCCGCCAGTGGAAGG - Exonic
1085750947 11:79160620-79160642 CAGTGACAGGTGCCAGGGTCAGG + Intronic
1086889962 11:92246113-92246135 CTCTGCCAGATGGCAGTGGATGG + Intergenic
1086960599 11:92976533-92976555 CTTTGATAGGGGACAGTGGAGGG - Intronic
1087932358 11:103992635-103992657 CTGTGACAGGTGCTAAAAGAAGG + Intronic
1089298493 11:117483793-117483815 CTGAGACAAGAGCCACTGGAAGG - Intronic
1089697985 11:120227521-120227543 ATCTGAGAGGTGTCAGTGGAGGG - Intronic
1089890953 11:121880122-121880144 CTGAGAAAGAAGCCAGTGGATGG - Intergenic
1089922802 11:122226817-122226839 CTGTGGGAGGAGCCAGTGCATGG + Intergenic
1090417537 11:126550933-126550955 TTGTGACAGGTGCCAGGGTGTGG - Intronic
1090743815 11:129691433-129691455 AAGTGACAGGTGCCTCTGGAAGG - Intergenic
1091937298 12:4443994-4444016 CTGTGAGAGGAGCCTGTGAAAGG - Intronic
1092211096 12:6646983-6647005 CTGCGGCAGGTGCCAGAGGCAGG + Exonic
1093218724 12:16393239-16393261 CTGTGAATGGTGACAGTGGTAGG + Intronic
1101049050 12:100841987-100842009 CTGAGACATGTGCCAGTGTTGGG - Intronic
1102222218 12:111202257-111202279 CTCTGACAGGTGTCAGGTGAGGG - Intronic
1103065901 12:117897188-117897210 CTGTGACAGATGCCAGTTTCAGG + Intronic
1103418351 12:120759928-120759950 CTGTGACAGCTCCCTGGGGAAGG - Intergenic
1103446299 12:120997318-120997340 TAGTGGCAGGTCCCAGTGGAGGG + Intronic
1103470287 12:121174931-121174953 CTGTGACAGGTGGCAGGGGAAGG - Intronic
1104776385 12:131392468-131392490 CTGTCTCAGGTGCCAGGGCATGG + Intergenic
1106135597 13:26971157-26971179 CTATGACAGGTGTCAGCTGATGG - Intergenic
1106206010 13:27595281-27595303 CTGTGATAAGTGGCAGTGGAAGG - Intronic
1107817534 13:44257313-44257335 GTGTGACAGGCGCCATTGGTTGG + Intergenic
1109753048 13:66721825-66721847 CTATAACAGGAGACAGTGGAAGG - Intronic
1110397639 13:75049966-75049988 CAGAGGCATGTGCCAGTGGAAGG + Intergenic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1113696355 13:112348827-112348849 CTGGGGCAGGTGCCACTGGCTGG + Intergenic
1114461999 14:22892420-22892442 TTGTGACTGCTGCCAGAGGAGGG + Intergenic
1116354689 14:43913955-43913977 ATGTGGCTGGTGCCAGAGGATGG - Intergenic
1118624746 14:67648092-67648114 CTGTGGCTGGAGCCAGTGTAGGG - Exonic
1119009187 14:70965853-70965875 CTATGACAAGTGCCATAGGAAGG - Intronic
1122101207 14:99411397-99411419 GTGTGTGAGGTGCCAATGGATGG + Intronic
1122822728 14:104355289-104355311 CTGTGCAAGGTGACAGTGGACGG - Intergenic
1122864777 14:104598727-104598749 CCGGGACTGGGGCCAGTGGACGG - Intronic
1123167171 14:106336883-106336905 CTGGGGCAGATGCCACTGGATGG + Intergenic
1123169787 14:106361594-106361616 CTGGGGCAGATGCCACTGGATGG + Intergenic
1124635604 15:31362930-31362952 ATTTGACAGGCCCCAGTGGAAGG + Intronic
1125180617 15:36878409-36878431 CTGTGAGAGGTGGCACTGCAAGG + Intergenic
1128072704 15:64807522-64807544 CTGTGCCAGGTCCCAGTAGAGGG + Intergenic
1128511551 15:68316668-68316690 CTGTGGCAGGAGCCAGTAGGCGG - Intronic
1131426199 15:92347234-92347256 CTGTGACAGCTGTCAGAGCAAGG + Intergenic
1132638658 16:966814-966836 CTGTGACAGGTGGAAGTAGTGGG - Intronic
1134598925 16:15518301-15518323 CTGTGACATTTTCCAGGGGAGGG + Intronic
1136598188 16:31266005-31266027 AGGGGACAGGAGCCAGTGGAAGG - Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141348684 16:83273001-83273023 GTGTGACTGGTGCCTGTGGCTGG + Intronic
1141704994 16:85659916-85659938 TTGTGACAGGGGCCACTGGGGGG + Intronic
1141962912 16:87421371-87421393 TTGTGACTGGTGGCAGAGGAAGG - Intronic
1143484637 17:7246953-7246975 CTGACACTGGTGCCAGCGGATGG + Intronic
1143774598 17:9189801-9189823 CTTTTACAGGTGCCAGTTAAAGG + Intronic
1144070999 17:11671110-11671132 CTGTGACAGATGCCCCAGGATGG + Intronic
1144328041 17:14200461-14200483 CAGAGCCAGGTGCCACTGGATGG + Intronic
1144334213 17:14254828-14254850 CGGTGACAGGAGCTGGTGGATGG - Intergenic
1145972287 17:28963447-28963469 CTGAGACATGTGGCAATGGAAGG - Intronic
1146052072 17:29562286-29562308 CAGTGACAGGTGACAGTGACTGG + Exonic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1146543956 17:33722109-33722131 CTGTGAAAGGACCCAGTGGGAGG + Intronic
1147120077 17:38330628-38330650 CTGGGACTGGTGCCAGGGCAGGG + Exonic
1147963027 17:44179185-44179207 GTGTGAGAGGAGCCACTGGAGGG - Intergenic
1148269033 17:46249361-46249383 GTGTGTCAGGCGGCAGTGGAGGG - Intergenic
1149100915 17:52905518-52905540 ATATGACAGGTGCCAGAGTAGGG + Intergenic
1150767685 17:68015134-68015156 GTGTGTCAGGTGGCAGTGGAGGG + Intergenic
1150944340 17:69728562-69728584 CTGAGACAGGTGTTAGAGGAAGG - Intergenic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152919635 17:83059507-83059529 GTGTGCCAGGTGGCAGTGGCTGG - Intergenic
1159560016 18:69983934-69983956 ATGTGAGAGGTGCCAGAGAAAGG - Intergenic
1159954542 18:74510085-74510107 GTGTGACAGGTGGCTGTGCACGG + Intronic
1160010818 18:75106020-75106042 CTGTGGCAGGTGGCAGGGGCTGG - Intergenic
1160435922 18:78852763-78852785 CTGTCACAGGAGCCAGAGAAAGG - Intergenic
1161713230 19:5861722-5861744 CAGTTGCAGGAGCCAGTGGAAGG - Intergenic
1162203100 19:9035521-9035543 CTGTGCCTGATGCCAGAGGATGG - Intergenic
1163234878 19:16024408-16024430 CTGTGGAAGGTGGCAGTGGTGGG - Intergenic
1163486696 19:17591844-17591866 GTGTTTCAGGTGACAGTGGAAGG + Intergenic
1163818552 19:19482977-19482999 CTGTGACAGGGGCCAGTCTCGGG - Intronic
1163906268 19:20151733-20151755 CGGTGACAAGTGGCAGTGGCAGG - Intergenic
1165247510 19:34505690-34505712 CTGTGACAGGTCCCAATGGCAGG - Exonic
1166812906 19:45524823-45524845 CTGTCACAGGTGCCAGAAAAGGG - Intronic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926767476 2:16334944-16334966 CTGTATCAGGTGCCTGTGCAAGG + Intergenic
927015609 2:18957071-18957093 CTGTCAGGGGTGCCAGGGGAGGG + Intergenic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
929542625 2:42834113-42834135 CTGTGCCCAGTGCCTGTGGATGG + Intergenic
929925405 2:46203023-46203045 CCATGACAGAGGCCAGTGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933997961 2:87683768-87683790 CTGGGCCATGTCCCAGTGGAGGG - Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937212728 2:120286747-120286769 CTGTGACAGGGGACAATGGAGGG - Intronic
937451207 2:122003261-122003283 CTCTGGCAGGTGGCAGAGGAGGG - Intergenic
937666894 2:124498242-124498264 CTTAGACAGGTGCCAGTTCAGGG - Intronic
937926978 2:127175080-127175102 CTGTGGGAGCTGCCAGTGGGTGG + Intergenic
938737776 2:134202111-134202133 CTGGGTCAGGTGGCAGAGGATGG - Intronic
939432692 2:142131040-142131062 CAGTGAGAGATGCCAGCGGATGG + Exonic
940207079 2:151214798-151214820 ATGTTACAGTTGCTAGTGGAAGG - Intergenic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
945910217 2:215640269-215640291 CTGTGACAGATACCACTGGAGGG + Intergenic
948458260 2:238117240-238117262 CTGTGACAGGGGCCAGGACAGGG + Intronic
948726170 2:239935345-239935367 TGGTGACCGGTGCCACTGGATGG + Intronic
948781587 2:240324855-240324877 CTGTCCCATGTGCCGGTGGAGGG - Intergenic
948926075 2:241099048-241099070 GTGTGACAGGAGCCAGAGGTGGG - Intronic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
949049419 2:241888999-241889021 CTGGGACAGCTGCCCGGGGATGG + Intergenic
1169830998 20:9824699-9824721 CTGTGATGGGTGGCAGTGAAGGG - Intronic
1169918189 20:10704770-10704792 CAGTGACATGTGCCAGTTTATGG - Intergenic
1170546571 20:17439907-17439929 CTGTCACGGGTCCCAGGGGAAGG + Intronic
1170733049 20:18990489-18990511 CTCTGAGAGGTGCCGGTGAATGG - Intergenic
1171210984 20:23316770-23316792 CTGTGACAGGCACAAGTGGCAGG - Intergenic
1171308159 20:24123691-24123713 CTGGGACTGGTGGGAGTGGAGGG + Intergenic
1172230591 20:33333260-33333282 CAGCGACAGGTGCCTGTGGGTGG - Intergenic
1172427358 20:34864011-34864033 CTATGCTAGGTGCCAGGGGACGG + Intronic
1172867673 20:38112618-38112640 CCCTGACAGGTGCCACAGGAGGG - Intronic
1172967288 20:38845995-38846017 CTGTGTCAAGTGACAGAGGAGGG + Intronic
1174500704 20:50982011-50982033 CTGTGGCAGGTGTCAGAGGTGGG + Intergenic
1176070272 20:63222599-63222621 CTGGGCCAGGTGCCTGGGGAGGG + Intergenic
1177890438 21:26798106-26798128 CTGTGACACTTTCCTGTGGACGG - Intergenic
1178479449 21:32967057-32967079 GTGAGAGGGGTGCCAGTGGATGG + Intergenic
1179173070 21:38988053-38988075 CTGTGGCAGGGGCCTGTGCAGGG - Intergenic
1179264969 21:39795277-39795299 GAGTGAAAGGTGGCAGTGGAAGG + Intronic
1179654585 21:42837522-42837544 CTTAGGCAGGTGCCAGGGGACGG - Intergenic
1180884165 22:19228022-19228044 GTGTGCCAGGTGGCAGGGGAAGG - Intronic
1181004053 22:20001276-20001298 CTGAGACAGGTGGGAGTGGCTGG + Intronic
1181500314 22:23312261-23312283 CTGTCACAAATGCCAGGGGAGGG + Intronic
1182299165 22:29328416-29328438 CCATGAGAGGTGGCAGTGGAGGG + Exonic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1183736386 22:39647046-39647068 CTCTGACAGGTGCCAGGAGAGGG - Intronic
1183916271 22:41122407-41122429 CTTTGAGAGGTGGCGGTGGATGG - Intronic
1184554217 22:45224657-45224679 CTGTGGCAGGCACCAGTAGAAGG + Intronic
1184657098 22:45947347-45947369 CAGTGACAGCTGCCAGGGGAGGG + Intronic
950422181 3:12905714-12905736 CAGTGACAGGCACCAGTGGTGGG - Intronic
950656587 3:14440657-14440679 CTGCCACAGATGCCAGTGCAAGG + Intronic
951170309 3:19534036-19534058 TTGTGACAACTTCCAGTGGAAGG - Exonic
952102464 3:30030573-30030595 CTGTGAGAAGTTACAGTGGAGGG + Intergenic
952865719 3:37853974-37853996 ATGTGAATGGTGCCAGTGGGAGG + Intergenic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
954220864 3:49153148-49153170 CAGTGACAGGTACCACTGGAGGG + Intergenic
954623287 3:52007788-52007810 CTGTGGCAGGTGTCCGTGGGTGG - Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
959265073 3:104126949-104126971 CTCTGCCATCTGCCAGTGGAGGG - Intergenic
960600987 3:119458200-119458222 CTGTGATAGGTGGGACTGGAAGG + Exonic
961722556 3:128906450-128906472 ATGTGCCAGGTGGCAGGGGAGGG + Intronic
961867958 3:129967793-129967815 ATGTGACGGGTGCCAGGGGATGG - Intergenic
961995739 3:131240181-131240203 CTGAGAAAGGAGCCAGAGGAAGG - Intronic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
963861341 3:150313622-150313644 CTGTGATGGGGACCAGTGGATGG - Intergenic
966722591 3:183079550-183079572 CTGTGAAAGCTGCCAGGAGAGGG - Intronic
966746633 3:183283252-183283274 CTGTGACAACTGCCAGCGGCTGG + Intronic
968491678 4:893545-893567 CTGTGACCTCTGCCAGTGCAGGG - Intronic
968787387 4:2632774-2632796 CTGCGAGAGATGCCAGAGGAAGG - Intronic
969708117 4:8824080-8824102 CTGTGACATGTAACAGTGCAGGG + Intergenic
970004359 4:11396456-11396478 CAGAGACAGGTGTCAGTGGAAGG - Exonic
970343550 4:15131179-15131201 CTGGGGCTGGTGCCAGAGGATGG + Intergenic
970465042 4:16314077-16314099 GTGTGCCAAGTGCCAGAGGAAGG - Intergenic
971240551 4:24884965-24884987 CTGTGACAAGTGGCAGTGACAGG + Intronic
973890632 4:55364241-55364263 CTGAGCCAAGTGCCAATGGATGG + Exonic
974320454 4:60341562-60341584 CTGTGCTGAGTGCCAGTGGAAGG + Intergenic
978126819 4:105146116-105146138 CGGGGAGAGGTGCCAGTGGGTGG + Intronic
978287696 4:107098279-107098301 ATGTGACTGCTGCCAGGGGATGG - Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
982650189 4:158078796-158078818 CTCTGGGAGGTGCCAGTGGGAGG - Intergenic
983082022 4:163397928-163397950 TGGTGACATGTCCCAGTGGATGG + Intergenic
985780335 5:1867552-1867574 CTGTGTCGGGAGCCTGTGGAAGG - Intergenic
986349783 5:6866810-6866832 ATGTGACACGTCCCAGAGGAGGG + Intergenic
989568708 5:42925471-42925493 CTGTGACAGTGGTCAGGGGAAGG - Intergenic
990342228 5:54834807-54834829 CTTTGACAGGTGACAAAGGAAGG - Intergenic
991245558 5:64505714-64505736 CTGAGACAGGGGCCACAGGAGGG - Intergenic
993943386 5:94089060-94089082 CTGTAACAGCAGCCACTGGAGGG + Intronic
996679999 5:126221207-126221229 CTGTGGCAAGTGCCAGTGAGAGG + Intergenic
997109941 5:131064122-131064144 CTGTGGCAGATGACAGAGGAAGG - Intergenic
997258664 5:132448709-132448731 CTGAGACAGGAGCCACTAGAGGG - Intronic
998929669 5:147167145-147167167 CTGTGGCAGCTGCCTGTGGTAGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999510875 5:152250495-152250517 CTGTGACAGGCCCCAGTGTGTGG + Intergenic
999824117 5:155257948-155257970 CAGTAACAGGTGCCAGTGTCAGG + Intergenic
999888933 5:155956126-155956148 CTGTGACAGGTGGGAGAGGTGGG - Intronic
999898520 5:156061639-156061661 CTATGCCAGGTGTTAGTGGAAGG + Intronic
1000418414 5:161009249-161009271 CTGTGAGAGATGCTAGGGGATGG - Intergenic
1000492079 5:161926268-161926290 CTGTGAAAGGAGCCAGAGGGAGG + Intergenic
1002181994 5:177435437-177435459 CTGTGAGGGAGGCCAGTGGAGGG + Intronic
1002941284 6:1718499-1718521 CAGTGACAGGTGCCAGAACATGG - Intronic
1003116112 6:3284812-3284834 CTGAGCCTGGTGCCAGGGGAAGG + Intronic
1007497272 6:42268851-42268873 CTGGCTCAGGTGCCAGTGCAGGG - Exonic
1008007720 6:46429652-46429674 CTGTGCCAGGTGCTAGAGAATGG + Intronic
1013423997 6:109994260-109994282 ATGTGACAGGTGTCACTGAATGG + Intergenic
1013742827 6:113308247-113308269 GTGCTACAGGTGCCAGTAGAAGG - Intergenic
1013891253 6:115030557-115030579 CTGTCTCAGGTGGCAGTGGAGGG - Intergenic
1014944293 6:127478517-127478539 CTGTGAGGTGTTCCAGTGGAGGG + Intronic
1015534104 6:134249572-134249594 CTGTGACAAGTGCTAGAAGAGGG - Intronic
1015834361 6:137404053-137404075 GTGTGCCAGGTGCTAGGGGAAGG + Intergenic
1016683964 6:146860776-146860798 CAGGGACAGAAGCCAGTGGAGGG - Intergenic
1018860072 6:167704760-167704782 CAGCGACAGCTGCCAGAGGAGGG - Intergenic
1018899700 6:168044866-168044888 CTGTGCCAGGTGCCTCTGGCTGG - Exonic
1018915586 6:168130625-168130647 CCTTGGCAGGTGCCGGTGGATGG - Intergenic
1019528092 7:1489804-1489826 CTTGGACAGGTGTCACTGGAGGG - Intronic
1019713312 7:2527154-2527176 CGGGTACAGGTGGCAGTGGATGG - Exonic
1022955631 7:35377712-35377734 CTGTGAGATGTGCCAGTGCCAGG + Intergenic
1023751716 7:43379363-43379385 CTGAGACAGTTGTCACTGGAAGG - Intronic
1025015456 7:55435619-55435641 CTCTGACAGGAGACAATGGATGG - Intergenic
1026252734 7:68685112-68685134 CTTTGACAGGTGCCGGGGAAGGG - Intergenic
1026559843 7:71439553-71439575 CTGTGACAGCTCCCAGCGGCAGG + Intronic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1029488803 7:100859153-100859175 TTGTGACAGGTGTCTGGGGAGGG + Exonic
1029538461 7:101169406-101169428 GTGTGACAGGTGGAAGTTGAAGG - Intergenic
1030678348 7:112408196-112408218 CTGAGAAACGAGCCAGTGGAAGG - Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034202386 7:149290519-149290541 CTGTGTAAGGTGCTAGAGGAGGG - Intronic
1035027541 7:155835890-155835912 GTGTCACAGGTGCCTGGGGAGGG - Intergenic
1035092919 7:156329399-156329421 CTGTGTCAGCTGCCAGAGGTGGG - Intergenic
1035879050 8:3223854-3223876 CTGTGACAGCTGCTTGTGGAGGG - Exonic
1037693715 8:21205855-21205877 GTGTTCCAGGTGCTAGTGGATGG + Intergenic
1038536436 8:28356530-28356552 CGGTCAGAGGTGCCAGTGGGAGG + Intronic
1039437087 8:37567082-37567104 CTAGGACAAATGCCAGTGGAGGG - Intergenic
1039549310 8:38431317-38431339 GTGTGACAGGTGCCAGGAGGGGG - Intronic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041277562 8:56178664-56178686 CTGTGACAGATACCAGGGGATGG - Intronic
1041417494 8:57627683-57627705 CTGTTAAAGGTGACAGTGAATGG - Intergenic
1042664578 8:71191582-71191604 CTGTGACAGGGACCAGGTGATGG + Intergenic
1043158903 8:76821135-76821157 CAGTGACAGGTGTCATAGGATGG - Intronic
1045016351 8:98004636-98004658 CTGTGAGAGGGGCCAGTGCCTGG + Intronic
1045385332 8:101666876-101666898 CCGTGGTAGGTGCCAGTGGATGG - Exonic
1046111921 8:109735817-109735839 CTCTGGCAGGTGGCAGGGGAGGG + Intergenic
1046810559 8:118528799-118528821 GAGTGACTGGGGCCAGTGGAGGG - Intronic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049175831 8:141192321-141192343 CTGTTACCTGTGCCTGTGGAAGG - Exonic
1049738111 8:144220880-144220902 CTATAACTGGTGCCAGTGTAGGG - Intronic
1049787943 8:144460093-144460115 CTGTGAGTGGTGCCCCTGGAAGG - Intronic
1050881150 9:10702084-10702106 CCATGACAGGTGGCAGAGGATGG - Intergenic
1051070352 9:13158648-13158670 CTGTGCCAGGTTCCTCTGGATGG - Intronic
1052140930 9:24982209-24982231 CTCTGAATGGTGCCAGTGGGAGG + Intergenic
1056304174 9:85272976-85272998 CTGAGACAGGTGGCTATGGAAGG - Intergenic
1056720756 9:89069747-89069769 CTGTGGCAGCTGCCAGAGGCAGG - Intronic
1057463043 9:95283312-95283334 ATGAGACAGGTGCCAGTGACAGG + Intronic
1058698033 9:107576310-107576332 CTGTGATAGGTGCATGGGGAAGG + Intergenic
1062197511 9:135282481-135282503 CTGTGCCAGGTGCCAAGGGCCGG + Intergenic
1062393162 9:136342101-136342123 CTGTGACCGATGGCAGTGGGTGG + Intronic
1062399084 9:136364624-136364646 CAGTTACAGGGGCCAGTGGGGGG - Intronic
1062690118 9:137837330-137837352 CTGTGACAGGGCCCAGTTGTGGG - Intronic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1188986695 X:36774490-36774512 CTATGATAGGTCCCAGTAGAAGG - Intergenic
1195469802 X:105219218-105219240 CTGTGACTGTTGCTTGTGGAGGG + Exonic
1200259091 X:154602443-154602465 CTGGGGCAGGAGCCAGTGGCGGG + Intergenic