ID: 1112302991

View in Genome Browser
Species Human (GRCh38)
Location 13:98247310-98247332
Sequence CAGGGTGTGTACTCTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112302983_1112302991 18 Left 1112302983 13:98247269-98247291 CCTAGAAGACGATGCGTGCCATC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG 0: 1
1: 1
2: 0
3: 18
4: 167
1112302982_1112302991 28 Left 1112302982 13:98247259-98247281 CCTTTCTACACCTAGAAGACGAT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG 0: 1
1: 1
2: 0
3: 18
4: 167
1112302984_1112302991 0 Left 1112302984 13:98247287-98247309 CCATCTACCAATAGTGTCACGCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG 0: 1
1: 1
2: 0
3: 18
4: 167
1112302987_1112302991 -7 Left 1112302987 13:98247294-98247316 CCAATAGTGTCACGCCCAGGGTG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG 0: 1
1: 1
2: 0
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112302991 Original CRISPR CAGGGTGTGTACTCTGTTGG TGG Intronic
903053688 1:20620264-20620286 CAGGGTGGGTGCTCTGGAGGGGG + Intergenic
903674093 1:25053659-25053681 CAGGGTGTGGAGTGTGGTGGTGG - Intergenic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
911740559 1:101382508-101382530 CAGGATGTGGACACTTTTGGGGG + Intergenic
913051618 1:115121485-115121507 CAGGGGGTGAATTCTGGTGGGGG - Intergenic
915234200 1:154468658-154468680 CAGGTTGTGGAATCTGTTGCTGG + Exonic
920673162 1:208020241-208020263 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
924402323 1:243699112-243699134 CAGGGAGTGTACTTTGTTCTGGG - Intronic
1065372652 10:25004709-25004731 TAGGTTGTTTACTCTGTTGATGG + Intronic
1066553153 10:36581774-36581796 CAGGCTGTGCACTTTGGTGGGGG - Intergenic
1068752481 10:60611251-60611273 GAAGGTGTGTGCTCTGTAGGAGG - Intronic
1071913005 10:90257092-90257114 CAGGACGTATACACTGTTGGTGG + Intergenic
1072024069 10:91436418-91436440 CAGGGTAAGTATTCTGTTTGTGG + Intronic
1072635521 10:97175505-97175527 GAGGATGTGCACGCTGTTGGTGG - Intronic
1075709170 10:124521543-124521565 CAGGCTCTGTCCTCTGTTGGTGG + Intronic
1079617469 11:22513044-22513066 CAGGGTGGGTTATGTGTTGGTGG - Intergenic
1080164837 11:29224491-29224513 GAGGGGGTGTGCTTTGTTGGGGG + Intergenic
1080513218 11:32995967-32995989 TAGGCTGTTTACTCTGTTGATGG + Intergenic
1086153568 11:83640335-83640357 AATGGTGTGTAGTCTGTTGGGGG + Intronic
1087535101 11:99432911-99432933 CACAGTGTGTACTTTCTTGGTGG - Intronic
1089420315 11:118327761-118327783 AAGGCTGTGTATTCTGTTGGTGG - Intergenic
1089564122 11:119362016-119362038 AAGGGTGGGTATTCTGTTGTGGG - Intronic
1089978269 11:122751496-122751518 CAGGAGGTGGGCTCTGTTGGTGG - Intronic
1090110835 11:123906845-123906867 TAGGGTCTGTTCTCTGCTGGTGG + Exonic
1094434358 12:30404805-30404827 AAGGTTGTTTACTCTGTTTGTGG + Intergenic
1097628018 12:62024654-62024676 AAGGTTGTTTACTCTGTTGATGG - Intronic
1097834044 12:64255587-64255609 CAACATGTGTACACTGTTGGTGG + Intergenic
1099358571 12:81668609-81668631 CAGGGTTTTTACTCTGTGGAGGG - Intronic
1100113178 12:91270480-91270502 AAGGGTGTGTACTCTTTGGATGG + Intergenic
1102884748 12:116512951-116512973 CAGTGTGTGTGCTCTTTGGGGGG - Intergenic
1103000920 12:117384769-117384791 CAGGGGGGCTGCTCTGTTGGAGG + Intronic
1104019008 12:124979431-124979453 CAGGATGAGTATTCTGTTGCTGG - Intronic
1104678893 12:130735259-130735281 GAGGATGTGTACACTGCTGGTGG - Intergenic
1106554046 13:30795087-30795109 CAGGGTTTGTCTTCTTTTGGGGG + Intergenic
1112112496 13:96317998-96318020 TAGGGTGTTTCCTCTGTTGAGGG + Intronic
1112302991 13:98247310-98247332 CAGGGTGTGTACTCTGTTGGTGG + Intronic
1112803739 13:103139399-103139421 GAGTGTTTGTACACTGTTGGTGG + Intergenic
1113607153 13:111617333-111617355 CAGGGGGTGTAATTTGCTGGAGG + Intronic
1113914430 13:113862341-113862363 CCGGGTGAGGACGCTGTTGGAGG + Intronic
1114733458 14:25018855-25018877 CATGGTGTGTTCTTAGTTGGTGG - Intronic
1116489434 14:45488834-45488856 GAGGATGTGTATGCTGTTGGCGG - Intergenic
1118471117 14:66076362-66076384 CTGTGTGAGTACTCTGTTTGTGG + Intergenic
1119718284 14:76874096-76874118 TAGGGTGTGTCCTCTGTGGCTGG + Intergenic
1120142820 14:80947443-80947465 CAGGATGTGTAATTTGTTGTAGG + Intronic
1121789944 14:96691446-96691468 GAGGGAGTGTACACTGTTGCTGG + Intergenic
1122224415 14:100265445-100265467 CAGACTGTGTGCTCAGTTGGGGG + Intronic
1123113029 14:105881886-105881908 CTGGGTCTGTCCTCTGTGGGAGG + Intergenic
1123115376 14:105892035-105892057 CTGGGTCTGTCCTCTGTGGGAGG + Intergenic
1123119911 14:105911700-105911722 GAGGGGGTGGACTCTGTTGGGGG + Intergenic
1124478240 15:30055045-30055067 CAGGGTCTCCACTCTGTTGTAGG - Intergenic
1124630505 15:31334161-31334183 CAGGGTGTCTTGTCTGTTTGGGG - Intronic
1125832178 15:42724795-42724817 CAGGGAGCGAACTCTGATGGAGG + Intronic
1126885620 15:53146210-53146232 CACGTTGTGAAGTCTGTTGGGGG + Intergenic
1128562890 15:68680060-68680082 CAGAGTGTGCACGCTCTTGGTGG + Intronic
1129659885 15:77547634-77547656 CACTGTGTGTGCTGTGTTGGGGG + Intergenic
1130192192 15:81748150-81748172 AAGTGTGTGTACACTGTGGGTGG - Intergenic
1131426140 15:92346866-92346888 GAGGATGTTTACTCTGGTGGTGG + Intergenic
1134563553 16:15231419-15231441 CATGGTGTGAACTCTGGAGGCGG + Intergenic
1135478675 16:22802122-22802144 TAGGGTGTGTACTCTTTTGATGG - Intergenic
1140199892 16:72886667-72886689 CAGGGTTTGTGCTTTGTTTGGGG - Intronic
1141420626 16:83913081-83913103 CAGGGTGTTCACTGTGTTGGGGG + Intronic
1143336948 17:6178590-6178612 CAGGCTGTGGACTCTGTTAGAGG - Intergenic
1146162469 17:30567299-30567321 CAGGGTTTGTAGTCTAATGGAGG - Intergenic
1146955213 17:36933298-36933320 CAGGGTGTGTACTCCGCATGGGG + Intergenic
1150501308 17:65653497-65653519 CATGGCGTGTACTCTGAGGGAGG + Intronic
1150533321 17:66009129-66009151 GAGCGTCTATACTCTGTTGGTGG - Intronic
1151972104 17:77463306-77463328 CAGACTGTGTGCTCTGATGGGGG - Intronic
1152842012 17:82575953-82575975 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842022 17:82576002-82576024 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842040 17:82576082-82576104 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842049 17:82576123-82576145 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842058 17:82576164-82576186 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842067 17:82576205-82576227 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1152842076 17:82576246-82576268 CAGCGTGTGTGCTCGGGTGGCGG + Intronic
1154453717 18:14502298-14502320 CAGGGTGTGTGCTGCGTTTGGGG - Intergenic
1157509742 18:48262359-48262381 CAGGGTGTGGACTCTGTAAGTGG - Intronic
1160433769 18:78830719-78830741 AAGGGTGTGTGCTCTATTTGGGG - Intergenic
1161275985 19:3417567-3417589 CTGGGTGTGTACTAAGTAGGTGG + Intronic
1165297956 19:34943710-34943732 CAGTGTGAGTACTCTGATGCCGG - Exonic
1166016073 19:39980296-39980318 CAGGGTGTCTGCTCTGTTTGTGG - Exonic
1166746021 19:45142238-45142260 CAGGATGTGCAGCCTGTTGGGGG + Intronic
1167717011 19:51149107-51149129 CCGGTTGTTTACTCTGTTGATGG + Intronic
1168552899 19:57313085-57313107 CTGTCTGTTTACTCTGTTGGTGG + Intergenic
925060653 2:887527-887549 GAGGGTCTGTGCTCTGTTGAGGG - Intergenic
926509585 2:13758087-13758109 CTTGGTGTGTATTCTGTGGGGGG + Intergenic
926722190 2:15969068-15969090 CAGGGTGGGGACTCAGTTGCAGG - Intergenic
929985000 2:46720821-46720843 AAGTGTGTGTACTCTGGAGGAGG + Intronic
932219611 2:69989617-69989639 CAGGCTGTTTACTCTGGGGGCGG - Intergenic
933831534 2:86214198-86214220 CTGGGAGTGTACACTGTTAGAGG + Exonic
934088556 2:88530703-88530725 CAGGGTTTGGTCTCTGGTGGGGG - Intergenic
934541794 2:95181395-95181417 CAGTGTGAGTCCTCTGATGGCGG - Exonic
935748139 2:106207389-106207411 CAGTGTGAGTTCTCTGTTGTTGG - Intergenic
935782840 2:106523149-106523171 CAGGGTTTGTTCTGTGTTCGGGG - Intergenic
936857181 2:116972845-116972867 TAGGTTGTTTACTCTGTTGCTGG + Intergenic
941820400 2:169838894-169838916 CACAGTGTCTACACTGTTGGTGG + Intronic
942688049 2:178554866-178554888 AAGGATCTGTACTCTGATGGTGG + Exonic
943408639 2:187519189-187519211 CAAGGAGTGTGATCTGTTGGAGG + Intronic
945672770 2:212821939-212821961 AAGGGAATGTTCTCTGTTGGGGG + Intergenic
945918207 2:215727178-215727200 CAGGCTGTTTACTCTCTTTGAGG - Intergenic
946591265 2:221250621-221250643 CAAGGTTTATACACTGTTGGTGG + Intergenic
1170200941 20:13743258-13743280 GAGGGTGTGTACACGGTTGGTGG + Intronic
1171045754 20:21808489-21808511 CAGGGGTTGTTATCTGTTGGTGG + Intergenic
1173458450 20:43222634-43222656 CAGGGTGTTTACTCGGGAGGTGG + Intergenic
1173922871 20:46759116-46759138 CTGGGTGTGTGCTCTGTCTGGGG + Intergenic
1175518656 20:59585524-59585546 CAGGGTGATTACTGTGCTGGGGG - Intronic
1175926460 20:62473918-62473940 CAGGGTGTCTACACTGGCGGGGG + Intronic
1176820465 21:13651007-13651029 CAGGGTGTGTGCTGCGTTTGGGG + Intergenic
1177947757 21:27492806-27492828 TAGGGTGGGCATTCTGTTGGTGG + Intergenic
1179130906 21:38636412-38636434 CAGAGGGTGAACTCTTTTGGTGG - Intronic
1180161487 21:46000438-46000460 AAGGGTGTCTCCACTGTTGGGGG + Intronic
1183846936 22:40549457-40549479 TACAGTGTGTATTCTGTTGGTGG - Intronic
1184470538 22:44693079-44693101 CAGGGAGTGGGCTCTGTTTGGGG + Intronic
1185147339 22:49146418-49146440 CAGAGGGTGTACTCTGGTGCAGG + Intergenic
953008793 3:39003969-39003991 TAGGTTGTTTACTCTGTTGATGG + Intergenic
953464510 3:43107208-43107230 AAGAATGTGTATTCTGTTGGTGG - Intergenic
954603517 3:51891308-51891330 CAGGGTGGGACCTCTGTGGGTGG + Intergenic
957434075 3:80151802-80151824 GAGGGTGTGTGCTTTGCTGGGGG + Intergenic
958986872 3:100790594-100790616 CAGTGTGTGTCCGCTGTTGTTGG - Intronic
960855502 3:122098390-122098412 CAGAGTGTGTGATCTTTTGGAGG + Intronic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
963202332 3:142598235-142598257 CAGGTTGTGTAAGCTCTTGGAGG + Intronic
963280323 3:143378160-143378182 CAGAGTATATACTCTATTGGGGG - Intronic
963383685 3:144563421-144563443 CAGGGTCTGTGCTCTGTTCTGGG + Intergenic
967364669 3:188672524-188672546 CAGTGTGTGTACGTTGATGGAGG + Intronic
969448084 4:7256799-7256821 CAGAGTGTGAGGTCTGTTGGGGG + Intronic
969715417 4:8865928-8865950 CAGGGTGGGGACTGGGTTGGGGG + Intronic
970450517 4:16162261-16162283 CAGGGTGTGTGTTCTGTGGGAGG - Exonic
973395074 4:49587033-49587055 CAGGGTGTGTGCTGCCTTGGGGG + Intergenic
975492203 4:75001796-75001818 GAGGGTGTTTCCTCTGATGGGGG - Intronic
978942101 4:114448598-114448620 AAGTGTGTGCACACTGTTGGGGG - Intergenic
980138231 4:128882647-128882669 GAGAGCTTGTACTCTGTTGGGGG + Intronic
981321278 4:143394814-143394836 CAGGTTGTTTATTCTGTTGATGG + Intronic
981718840 4:147778815-147778837 CAGGGAATGAATTCTGTTGGAGG + Intronic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
983783344 4:171700769-171700791 CTGGGTGTGGACTCTTTAGGAGG + Intergenic
1202762657 4_GL000008v2_random:125596-125618 CAGGGTGTGTGCTTCCTTGGGGG - Intergenic
986053735 5:4115098-4115120 CAGTGTGTGACCTCTGATGGGGG + Intergenic
989490960 5:42052693-42052715 AAGGGAGTGTATTCTATTGGTGG - Intergenic
989545912 5:42672959-42672981 TAGGCTGTTTACTCTGTTGCTGG - Intronic
990575238 5:57117547-57117569 CATGGTGCGTACCCTGATGGAGG - Intergenic
991146014 5:63305099-63305121 TAGGCTGTTTACTCTGTTGATGG + Intergenic
997709817 5:135994853-135994875 CAGTCTGAGTACTGTGTTGGGGG + Intergenic
997801445 5:136866482-136866504 CTGGGTGTCTACTCTGTGGCTGG + Intergenic
998900444 5:146847565-146847587 CAGGGCTTGTGCTCTGTTGGTGG + Intronic
999938056 5:156509486-156509508 CAGAGTGTGTACCCTGTTCTAGG + Intronic
1003147541 6:3521315-3521337 CAGGGTCTGGAATCAGTTGGCGG + Intergenic
1004285477 6:14317099-14317121 AAGAGTGTGTACTCTGGTGTTGG + Intergenic
1005012358 6:21348228-21348250 CAGGGTGTGTACCCCTTTGATGG - Intergenic
1007730862 6:43945116-43945138 GAGGGTGTGTGCTCTTTTAGGGG + Intergenic
1007811309 6:44487870-44487892 AAGGCTGTCTAGTCTGTTGGAGG + Intergenic
1009461356 6:63917890-63917912 CATGGTGTGTACTTTGTTAAGGG - Intronic
1010333357 6:74650665-74650687 CAGTGTTGGTACACTGTTGGTGG - Intergenic
1014189242 6:118473901-118473923 CAGGGTGTTTATTTTGGTGGTGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016719018 6:147271344-147271366 AAGAATGTCTACTCTGTTGGTGG - Intronic
1021916972 7:25443864-25443886 GAGCATGTGTGCTCTGTTGGGGG + Intergenic
1022730141 7:33015170-33015192 GAGGATGTGTATTCTGTAGGAGG - Intronic
1024075956 7:45817989-45818011 CAGGCTGTGTACCCTGCTGTGGG + Intergenic
1024899607 7:54303657-54303679 TAGGCTGTTTACTCTGTTGATGG - Intergenic
1030099514 7:105933245-105933267 GAGGGTGTGTACACTGTTAAGGG - Intronic
1035402311 7:158574933-158574955 GAGGGTGAGTAGTCTGGTGGTGG - Intronic
1035602523 8:905209-905231 CAGGGTGGGCACTGTGTTTGTGG + Intergenic
1038252076 8:25914343-25914365 CTGGGTGTAGACTCTGCTGGGGG - Intronic
1038390315 8:27192249-27192271 CAGAGTGTATACTCTATTGAAGG + Intergenic
1039611730 8:38924464-38924486 AAGGGTGTGAACTCAGGTGGAGG + Intronic
1042857014 8:73277775-73277797 CAGGCTGTTTCCTCTGTTGAGGG - Intergenic
1045607885 8:103798749-103798771 CAGGGTGTGGACATTTTTGGAGG - Intronic
1046839556 8:118841632-118841654 CATGGTGTGTAAGCTGTTGGCGG - Intergenic
1048434509 8:134403501-134403523 CAGGGTGTGTAGGATGTTGGAGG - Intergenic
1050976813 9:11949469-11949491 CCCAGTGTGTGCTCTGTTGGGGG + Intergenic
1052998178 9:34562754-34562776 CAGAGTATTCACTCTGTTGGTGG + Intronic
1056205470 9:84315626-84315648 CAAGGCGTATACTCTGTTGGGGG - Intronic
1056331968 9:85528654-85528676 CAAGGTGTATACCCTGTGGGTGG + Intergenic
1056829386 9:89902594-89902616 CAGTGTGTGGAGTGTGTTGGGGG - Intergenic
1057132442 9:92663741-92663763 CAGAGTGAGTCCTCTGTGGGTGG - Intronic
1059822342 9:117987076-117987098 CAGGGTTTGTACTCTGGTGTTGG - Intergenic
1061216632 9:129225459-129225481 CAGGGTGAGCACTCTGCTTGTGG - Intergenic
1203526786 Un_GL000213v1:97914-97936 CAGGGTGTGTGCTGCGTTTGGGG - Intergenic
1203543420 Un_KI270743v1:110477-110499 CAGGGTGTGTCCTTCCTTGGGGG - Intergenic
1186262386 X:7793012-7793034 CACAGGGTGTACTCTTTTGGTGG - Intergenic
1186754730 X:12658581-12658603 CAGGTTGTGTGCTCTGTTGATGG - Intronic
1190648369 X:52544223-52544245 CAGAATCTGTCCTCTGTTGGGGG - Intergenic
1192451392 X:71247310-71247332 CAGGGGGTACACTCTGTTAGAGG - Intronic
1195990651 X:110678959-110678981 AAGGGTGTATCCTCTGGTGGTGG - Intronic
1200403374 Y:2782874-2782896 CAGTTTATGTACACTGTTGGTGG - Intergenic
1200908422 Y:8509375-8509397 CAGCCTGTGTCCTCTGTGGGGGG + Intergenic
1201345240 Y:12976326-12976348 CAGAGTGTGGGCTCTCTTGGGGG + Intergenic