ID: 1112306511

View in Genome Browser
Species Human (GRCh38)
Location 13:98279697-98279719
Sequence GTGATGTCCCTGACATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112306511_1112306513 -2 Left 1112306511 13:98279697-98279719 CCAGGGGATGTCAGGGACATCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1112306513 13:98279718-98279740 ACCATTGCATATACCCTGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1112306511_1112306512 -6 Left 1112306511 13:98279697-98279719 CCAGGGGATGTCAGGGACATCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1112306512 13:98279714-98279736 CATCACCATTGCATATACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
1112306511_1112306516 2 Left 1112306511 13:98279697-98279719 CCAGGGGATGTCAGGGACATCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1112306516 13:98279722-98279744 TTGCATATACCCTGGTAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1112306511_1112306515 1 Left 1112306511 13:98279697-98279719 CCAGGGGATGTCAGGGACATCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1112306515 13:98279721-98279743 ATTGCATATACCCTGGTAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112306511 Original CRISPR GTGATGTCCCTGACATCCCC TGG (reversed) Intronic
901868450 1:12123421-12123443 GAGCTGTCCCTGCCATGCCCAGG + Intronic
902691866 1:18115026-18115048 GTGAGGACACTGACATGCCCAGG + Intronic
903791128 1:25893887-25893909 GTGATGTCCCTGATAACCACAGG + Intronic
909474366 1:76065484-76065506 GTGATGTCACTCCCATTCCCTGG + Intergenic
912690090 1:111798361-111798383 GGGCTTTCCCTGACTTCCCCAGG + Intronic
920496255 1:206456957-206456979 CTGACATCCCTGACTTCCCCAGG + Intronic
920558696 1:206923159-206923181 GGGATGTGCCTGACAGACCCGGG + Intronic
921780076 1:219152454-219152476 TTCATGTCCCTGACATTCACTGG - Intergenic
1063618810 10:7626103-7626125 GTGATCTGCATCACATCCCCCGG + Intronic
1064483170 10:15759822-15759844 GGGCTTTCCCTGACCTCCCCAGG + Intergenic
1065489696 10:26270358-26270380 GGGACGTCCCTGACAGCCTCTGG + Intronic
1067345816 10:45438476-45438498 GACATGTTCCTGACATCCTCTGG - Intronic
1071975072 10:90947340-90947362 GTCATTTCCCTGGCACCCCCTGG - Intergenic
1077315711 11:1918524-1918546 ATGAGGTCCCTGTCCTCCCCAGG - Intergenic
1079542583 11:21593934-21593956 GCAAGGTCCCTGACATGCCCTGG - Intergenic
1081642097 11:44763115-44763137 CTGATGCCCCTTACAACCCCAGG - Intronic
1084443003 11:69186721-69186743 TTCATGACCCTGGCATCCCCAGG + Intergenic
1091397324 12:161932-161954 ACGATGGCGCTGACATCCCCAGG + Exonic
1091953293 12:4613676-4613698 GAGGTGTCCATGACCTCCCCAGG + Exonic
1092750979 12:11719037-11719059 GTGATTTCTCTGGCATCTCCAGG + Intronic
1095300881 12:40582174-40582196 GTGAAGTCTCTGACATACACTGG + Intergenic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1099722501 12:86382578-86382600 TTGAAGTCTCTGACATGCCCTGG - Intronic
1100775176 12:97965813-97965835 GTGCTGTCCCAGGCATCCCTAGG + Intergenic
1107935136 13:45340490-45340512 ATCATGTCCCGGACAACCCCGGG + Intronic
1109886619 13:68553382-68553404 GTGCTGTTCCTGACCGCCCCTGG - Intergenic
1109906203 13:68845761-68845783 GTGAAGTCTCTGAAATGCCCTGG - Intergenic
1112306511 13:98279697-98279719 GTGATGTCCCTGACATCCCCTGG - Intronic
1112826641 13:103398998-103399020 GTGAAGTCTCTGACATGCCCTGG + Intergenic
1113497588 13:110743956-110743978 GTGAAGTCTCTGACATGCCATGG + Intergenic
1117061874 14:51971951-51971973 GGAATGTCCCTGTCATCCCTTGG + Intronic
1120734069 14:88033952-88033974 GAGATGACCCTGAACTCCCCAGG - Intergenic
1120810169 14:88794591-88794613 GTGAGTTCCTTGAAATCCCCTGG + Intergenic
1125889256 15:43253483-43253505 GTGAGGTCCCTGGCGTGCCCGGG - Intronic
1126331688 15:47539191-47539213 GTGATGTGCTTGTCATCACCTGG + Intronic
1128670813 15:69573513-69573535 GTGAAGTCACTGATAGCCCCTGG - Intergenic
1131463674 15:92637787-92637809 GTGATGAAGCTGAAATCCCCTGG + Intronic
1131854435 15:96578671-96578693 CTGATCTGTCTGACATCCCCAGG + Intergenic
1132644391 16:992066-992088 CTGACGTCCCTGTCACCCCCTGG - Intergenic
1135719982 16:24808108-24808130 CTGTTGTCTCTGACATCACCTGG - Intronic
1136606253 16:31336065-31336087 TTGCTGTCCCTGACATCACATGG + Intergenic
1136632553 16:31497366-31497388 CTGATGGCCCTGACCTCCCAGGG + Intronic
1137609231 16:49807871-49807893 GGGAGGTCCCTGCCAGCCCCGGG - Intronic
1138261149 16:55623648-55623670 GTCATGTCCCTTACCTTCCCTGG + Intergenic
1138937547 16:61747881-61747903 GTGGTCTCCTTGACATCGCCGGG + Intronic
1139142770 16:64288149-64288171 GTGTTCTCCCTGACATGCCAGGG + Intergenic
1140913182 16:79471882-79471904 GTGATGTCACTCATATCACCTGG - Intergenic
1141768717 16:86075568-86075590 CTGAAGACTCTGACATCCCCTGG + Intergenic
1147572313 17:41579058-41579080 TGGAAGTCCCTGGCATCCCCTGG + Intergenic
1150008931 17:61487254-61487276 GAGATTTCCATGCCATCCCCCGG + Intergenic
1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG + Intronic
1150663597 17:67108924-67108946 ATGATGATCCTGACATCCACTGG + Intronic
1155701296 18:28747321-28747343 GTCATCTCCCTCCCATCCCCCGG + Intergenic
1156673661 18:39501532-39501554 TAGATGTCCTTGACATCTCCTGG + Intergenic
1156973054 18:43181340-43181362 TTGTTGACCCTGACATGCCCTGG + Intergenic
1157548186 18:48562529-48562551 GAGATGGCCCTGAGATCCCGGGG - Intronic
1158020639 18:52837214-52837236 GTGAAGTCTCTGACATGCTCTGG + Intronic
1159013888 18:63085655-63085677 CTCATGTCCCTGAAATCTCCTGG - Intergenic
1160874579 19:1291128-1291150 GGGCTGTCCCTGGCTTCCCCCGG - Intronic
1162497073 19:11029284-11029306 GTCGTGTCCCTGACTCCCCCAGG + Intronic
1162826283 19:13254310-13254332 GTGAGGACCCTAAAATCCCCAGG - Intronic
1164629040 19:29749161-29749183 GTGATGTCAGTGACAAGCCCAGG + Intergenic
1166294466 19:41882359-41882381 GGGATCTCCCTGCTATCCCCAGG - Intergenic
926331902 2:11832513-11832535 GAGATGCCCTTGACATCCACGGG + Intergenic
929000789 2:37345076-37345098 GTGATGTCACTGGCCTCTCCTGG + Intronic
929727017 2:44440272-44440294 GTGATTTCCCTGAGGTCCCGAGG - Intronic
930834378 2:55777545-55777567 CTGATGGACCTGACATGCCCAGG + Intergenic
934694748 2:96391512-96391534 GTGTTCTCCCTGGCATCCCAGGG + Intergenic
937277333 2:120693397-120693419 GTGATGCTGGTGACATCCCCTGG - Intergenic
940108337 2:150123429-150123451 GTGATGTCCCAGTCATCCCTTGG + Intergenic
941526468 2:166612305-166612327 GTTATGACCCTGATATCACCAGG + Intergenic
948225348 2:236305506-236305528 CTGCTGTTTCTGACATCCCCAGG - Intergenic
1170875329 20:20244629-20244651 CTGCTGTCTCTGACATGCCCTGG + Intronic
1177844345 21:26271424-26271446 GCCATGTTGCTGACATCCCCAGG - Intergenic
1178643713 21:34367064-34367086 GTACTTTCCCTGACCTCCCCAGG - Intronic
1180156562 21:45980492-45980514 GGGCTGTCCCTGATATCACCTGG - Intergenic
1181495569 22:23285632-23285654 GTGTTTTCACTGGCATCCCCGGG + Intronic
1182330231 22:29546281-29546303 GTGAGGTCTCTGACATGGCCTGG + Intronic
1182843248 22:33409324-33409346 GTGATGTCACTGGCAGCCCCAGG + Intronic
1183319447 22:37156124-37156146 GTGTGGACCCTGACATCTCCTGG - Intronic
1185210943 22:49570151-49570173 CTGATGTCCCTGACTCCCCTTGG - Intronic
949259982 3:2094812-2094834 GTTATGTTCCTGACAGCCTCTGG - Intergenic
953366189 3:42347543-42347565 CTGATGTCCCTGATGTCCCGGGG - Intergenic
957940317 3:86995193-86995215 CAGATGTACCTGACTTCCCCTGG + Intergenic
959577571 3:107950753-107950775 GTGAGGTCTCTCACATCCCCAGG + Intergenic
961452330 3:127008014-127008036 GTGACATCCCAGACATCCACAGG - Intronic
962304940 3:134277764-134277786 TTGATGTCTCTCCCATCCCCCGG - Intergenic
966931733 3:184679584-184679606 GTACTGGCCCTGACATCCCAAGG + Intronic
968506130 4:972254-972276 GGGAAGCCCCTGGCATCCCCAGG + Intronic
969993109 4:11284183-11284205 GTGAAGACCTTGACATGCCCTGG + Intergenic
976705118 4:88011975-88011997 GGGATGCCCCTGGCATCTCCTGG + Intronic
977422137 4:96815198-96815220 GTGATGGCCCTGACATGAACAGG + Intergenic
988516122 5:31906331-31906353 GTGGTAACCCTGACCTCCCCAGG + Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
994375915 5:99015577-99015599 CTGAGGTGCCTGACGTCCCCAGG - Intergenic
994781560 5:104095823-104095845 GTGAAGTGTCTGACATGCCCTGG + Intergenic
994924302 5:106094406-106094428 CTGATGTCGGTGAAATCCCCAGG - Intergenic
996214371 5:120849061-120849083 CAGATGTCTCTGACATGCCCTGG + Intergenic
1001034915 5:168291079-168291101 GTGTTTTCCCTGACACCCTCTGG + Intergenic
1002001341 5:176197914-176197936 GTGTTGTCCCTGACCTCCCATGG + Intergenic
1002252998 5:177941055-177941077 GTGTTGTCCCTGACCTCCCATGG - Intergenic
1002314458 5:178334073-178334095 TTGAGGACCCGGACATCCCCAGG - Intronic
1002924879 6:1599556-1599578 GTGATGCCTCTGAAACCCCCGGG - Intergenic
1006193681 6:32224161-32224183 CTTCTGTCCCTGACAACCCCTGG + Intergenic
1006201586 6:32297523-32297545 GTGCTCTCCCTGACAACCACTGG - Intronic
1010981778 6:82376868-82376890 GGAAGGTCTCTGACATCCCCTGG + Intergenic
1020605927 7:10336851-10336873 GTGATGTCGCTGACCTCAACTGG - Intergenic
1021400886 7:20208760-20208782 TTGAAGTCTCTGACATGCCCCGG - Intronic
1024192103 7:47022835-47022857 GTCTTGTCCCTTACGTCCCCAGG + Intergenic
1025611073 7:63076058-63076080 GTGATGTGCCCGACATTCTCTGG - Intergenic
1026953706 7:74363960-74363982 GTGTTGTCACTCACATCCCCGGG + Intronic
1027977547 7:85178770-85178792 GTGAAGTCTCTGACATGCCCTGG - Intronic
1028897937 7:96062988-96063010 GTGATGTTCCTGATACCACCGGG - Intronic
1031170849 7:118290661-118290683 GTCAAGTCTCTGACATGCCCTGG - Intergenic
1031982488 7:128136646-128136668 GTGATGACAGTGACAACCCCAGG + Intergenic
1034851860 7:154501359-154501381 GTGATGACTCTGACATGGCCTGG - Intronic
1039004839 8:33023380-33023402 ATGATGTTCTTGATATCCCCAGG + Intergenic
1046890706 8:119417777-119417799 GTGATGTCCCCAAGGTCCCCTGG - Intronic
1046917356 8:119691885-119691907 ATCATGTCTCTGACATACCCTGG - Intergenic
1048080361 8:131120108-131120130 GACATGTCACTGACAGCCCCCGG - Intergenic
1048805558 8:138237966-138237988 GTGATATCCCTGACACTGCCTGG - Intronic
1049658412 8:143808970-143808992 TCGATCTCCCTGTCATCCCCGGG + Exonic
1049786326 8:144452570-144452592 GTGATGTACCTGCCTCCCCCAGG - Exonic
1056099233 9:83284884-83284906 GTGAAGTCTCTGACAGCCCAAGG - Intronic
1058424436 9:104864277-104864299 GGGATGGTCCTGACATCCCTGGG - Intronic
1059045416 9:110861497-110861519 GGAAGGTCCCTGACATGCCCTGG - Intergenic
1186742559 X:12533971-12533993 GTGAAGACTCTGACATGCCCTGG - Intronic
1190743012 X:53302744-53302766 GGGATCTCCCTGTGATCCCCAGG - Intronic
1191250799 X:58259295-58259317 GTGATGTCACGGTCATCCACGGG - Intergenic
1192125663 X:68498891-68498913 GAGCTGTCCCTGACACCCCGAGG + Exonic
1194054737 X:89117490-89117512 GAGATGCCTCTGACATGCCCTGG + Intergenic
1197023517 X:121718370-121718392 ATGAAGACCCTGACATGCCCTGG + Intergenic