ID: 1112313061

View in Genome Browser
Species Human (GRCh38)
Location 13:98336735-98336757
Sequence AATGAAAAGCCAATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 365}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112313052_1112313061 22 Left 1112313052 13:98336690-98336712 CCCCATGAATGTAAACCTCCTCC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365
1112313054_1112313061 20 Left 1112313054 13:98336692-98336714 CCATGAATGTAAACCTCCTCCTA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365
1112313056_1112313061 4 Left 1112313056 13:98336708-98336730 CCTCCTAAGTTTAATTTTATAGG 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365
1112313058_1112313061 1 Left 1112313058 13:98336711-98336733 CCTAAGTTTAATTTTATAGGCTC 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365
1112313053_1112313061 21 Left 1112313053 13:98336691-98336713 CCCATGAATGTAAACCTCCTCCT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365
1112313055_1112313061 7 Left 1112313055 13:98336705-98336727 CCTCCTCCTAAGTTTAATTTTAT 0: 1
1: 0
2: 1
3: 36
4: 376
Right 1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112313061 Original CRISPR AATGAAAAGCCAATTGAGGA TGG Intronic
902476049 1:16688333-16688355 AATGAAAAACCACTGGAGAAGGG - Intergenic
905529513 1:38665990-38666012 AAAGAAAAGCCAATTGCAAAAGG + Intergenic
906633973 1:47395965-47395987 AAAAAAAAGCAAATGGAGGAGGG - Intergenic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
907374404 1:54023949-54023971 TATGAAAAGGCAATTCACGAGGG - Intergenic
907576821 1:55534208-55534230 AATTAAAAGTTACTTGAGGAGGG + Intergenic
908386762 1:63650292-63650314 AATTAATAGCCAATAGAGGCTGG + Intronic
908414358 1:63898536-63898558 AATGAAAGGACAAAGGAGGAGGG + Intronic
909545983 1:76846898-76846920 AATGAAAAGGCAATATGGGAAGG - Intergenic
909749378 1:79139708-79139730 AATGAAAAGCAAATTTAGCAGGG - Intergenic
909772161 1:79437442-79437464 AAGAAAAAGAAAATTGAGGATGG + Intergenic
909821506 1:80068265-80068287 AATGAAAAACAACTTGAGGTGGG - Intergenic
910026928 1:82666450-82666472 AATGGAAAGTCACTTCAGGATGG - Intergenic
910376638 1:86579264-86579286 AAGGAAAAGACAAGTGAAGAAGG + Intronic
910539048 1:88334009-88334031 AATGAACAGACATTTGAGGTGGG - Intergenic
911036371 1:93553543-93553565 AATAAAAAGACAATTGGGGGAGG - Exonic
911451718 1:98070311-98070333 AATGAAAATCCAATTGCAAAGGG - Intergenic
911523059 1:98951671-98951693 AATAAAAGGACAATTTAGGAAGG - Intronic
912924528 1:113902325-113902347 AATGAAAAGTCAAATTAGGCTGG - Intronic
915967696 1:160326229-160326251 AAAGGAAAGCCATTTGAGGTTGG + Intronic
917903020 1:179562101-179562123 AATTAAAATCCAATTGAGGCTGG - Intronic
918247806 1:182675264-182675286 ATTTAAAAACCAATTTAGGAAGG - Intronic
919082842 1:192887287-192887309 AATGAAAAGACACATGGGGAAGG + Intergenic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
921823056 1:219639905-219639927 AAAGAAAAGCCATTTGTGTATGG + Intergenic
921948123 1:220902383-220902405 AAAGAAAACCCAACTGAAGATGG + Intergenic
922482969 1:225951786-225951808 AATGAAATGCCAAAGGGGGAAGG - Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
1063595529 10:7431776-7431798 AATGGCCAGACAATTGAGGAAGG - Intergenic
1064372940 10:14769680-14769702 AATAAAGAGCCAATTGTGGCCGG - Intronic
1064605540 10:17035098-17035120 AATGAAAACGCAATTGAAAAAGG + Intronic
1065171943 10:23039665-23039687 AATAAAAAGCAAATTTAGGATGG + Intergenic
1065304278 10:24354099-24354121 TATGAACTGCCAATTGATGATGG + Intronic
1065633274 10:27703987-27704009 AATGATAAGCAAATTTATGATGG + Intronic
1065743654 10:28819008-28819030 ACTGGAAAGCCTATTGAGTAAGG - Intergenic
1065820074 10:29517268-29517290 AATAAAAAGCCAGCTGAGCATGG + Intronic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1068091836 10:52441354-52441376 AATGAAAACCCAACTGAAGCTGG - Intergenic
1070201492 10:74209991-74210013 AATGAAATGGTAATTGAGAAAGG + Intronic
1070471477 10:76784575-76784597 AATGAAAAGGCAATTAAGAAAGG - Intergenic
1070650195 10:78229702-78229724 AATGAAATGCAAATTGAAGCTGG - Intergenic
1071332588 10:84574642-84574664 AATGAACAGCCCACAGAGGAGGG - Intergenic
1071883643 10:89926759-89926781 AATGCAAAGCCAAAGGAGAAAGG - Intergenic
1072288159 10:93936801-93936823 ATTGGAAAGTCAATTGAGGCTGG + Intronic
1072867884 10:99083708-99083730 AATGAAAAGATAGTTGAGAAGGG - Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073753125 10:106552138-106552160 AATGGACAGCCCATTTAGGAAGG + Intergenic
1073798523 10:107014907-107014929 AAGGAATAGCCAATTGTGGTTGG + Intronic
1074097757 10:110329023-110329045 AATGGAAACCCAATTCAGGCTGG - Intergenic
1074474868 10:113762337-113762359 AATCTAAAGTCAATAGAGGAAGG - Intronic
1075118619 10:119648059-119648081 AGTGGAAAGCAAATTGAGCAAGG + Intergenic
1075420786 10:122298974-122298996 AAAAAAAAGCCAGTTGATGAAGG - Intronic
1076211265 10:128646866-128646888 AATGACAACCCAGCTGAGGAGGG + Intergenic
1076265869 10:129109600-129109622 CATGAAAAGCCAATTAGAGAGGG + Intergenic
1076266320 10:129112280-129112302 CATGAAAAGCCAATTAGAGAGGG + Intergenic
1078236315 11:9488037-9488059 ACTGAAAAGACAAATGAGGTAGG - Intronic
1078761191 11:14253214-14253236 AATGGAAAGTCCATTCAGGAAGG + Intronic
1080243280 11:30151707-30151729 AATGAAAAGTTAATGGAGGTTGG - Intergenic
1080341520 11:31271098-31271120 AATGAAGAGGCAATTAGGGAAGG - Intronic
1083107780 11:60375199-60375221 AATGAAAACACCATAGAGGAAGG + Intronic
1084093961 11:66897948-66897970 ACTGAAAAGAAAATTGAGGCTGG + Intronic
1085852186 11:80134215-80134237 AATGAAAGGCCAAATCAGAAAGG - Intergenic
1086166933 11:83790229-83790251 TATGAACAGCCAAATGTGGAAGG - Intronic
1087383909 11:97445609-97445631 AATGAACAGCCATTGGAAGAGGG - Intergenic
1087526180 11:99316232-99316254 AATCATAAGGCAATTGATGATGG + Intronic
1087645002 11:100798849-100798871 AAGAGAAAGCCATTTGAGGAAGG + Intronic
1088363708 11:109017457-109017479 AATGAAAAGCATTTTAAGGAGGG + Intergenic
1088550513 11:111008400-111008422 AATGAAAAACTACATGAGGATGG - Intergenic
1089478779 11:118789036-118789058 AATCAAAAGCCAACAGAGTAGGG - Intronic
1090324754 11:125875283-125875305 AATGCAAAGCCATTTCATGAGGG + Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1091924881 12:4337838-4337860 AATGAAAAACCAGTTGGGCATGG + Intronic
1092465356 12:8726944-8726966 AATGAAATGCCAAGAAAGGAGGG - Intronic
1092510335 12:9148666-9148688 AATGAAAATTCAGTTGAGAAAGG - Intergenic
1092922332 12:13243779-13243801 AATAACAAGCCAGTTGAGGTTGG + Intergenic
1093297719 12:17411572-17411594 CATGAAAAGACATTTGAGAAGGG - Intergenic
1093417085 12:18931955-18931977 AATGAAAAATCAAGTGAGTAAGG - Intergenic
1093642376 12:21542344-21542366 AATTAAAAGTCAATTTAGGCTGG - Intronic
1093781309 12:23140468-23140490 AATGAAAATCAAATTGAAGAGGG - Intergenic
1094585617 12:31774893-31774915 AATGAAAACTCTATTGATGATGG - Intergenic
1095232710 12:39760674-39760696 AATGAAAAACAAATTAAGAAAGG - Intronic
1095956674 12:47810525-47810547 GATGAAAAAGGAATTGAGGATGG - Intronic
1096094267 12:48924338-48924360 AGGGAAAGGTCAATTGAGGATGG - Intronic
1099775500 12:87122714-87122736 AAGAAACAGCCTATTGAGGAAGG + Intergenic
1100139032 12:91593473-91593495 AATGGTAAGCAAATTCAGGAGGG - Intergenic
1100944930 12:99771207-99771229 AAAGAAATTCAAATTGAGGAAGG - Intronic
1101224865 12:102678064-102678086 AATGGAAAGACATTTGTGGAAGG - Intergenic
1101261291 12:103033457-103033479 AAAGCAAACCGAATTGAGGAAGG + Intergenic
1102006167 12:109590551-109590573 AGTGAAAAGCCAAGGGAGAATGG + Intronic
1102586566 12:113927184-113927206 GATGAAAATCCAACAGAGGAAGG - Exonic
1102624402 12:114223169-114223191 AATGAAAAGCAAAATGAGAAGGG - Intergenic
1103032680 12:117630060-117630082 AATCCAAAGCCACTTGAGAATGG - Intronic
1103749192 12:123147923-123147945 AATGAAAAGGAAAGTGGGGAAGG - Intronic
1105941446 13:25151553-25151575 AATGAAAAGCAAATATTGGAAGG - Intergenic
1106236328 13:27863806-27863828 AATGAAAAGCTAATAGCTGATGG - Intergenic
1107104620 13:36630078-36630100 GCTAAAAAGCCAATGGAGGAGGG + Intergenic
1108826345 13:54416640-54416662 TGTAAAAAGCCAATTGTGGAGGG + Intergenic
1110211691 13:72980915-72980937 AAAGATAGGACAATTGAGGAAGG + Intronic
1110736270 13:78940670-78940692 GATGAAAAGGCAGTGGAGGAGGG + Intergenic
1111089336 13:83422475-83422497 AAAGAAAAGGAAATTGAGCATGG + Intergenic
1111127747 13:83934327-83934349 AATGAAAATCCAAAAGAGGCTGG + Intergenic
1111154705 13:84307735-84307757 TATAAAAATCCAATTGAGGCTGG + Intergenic
1111951084 13:94709965-94709987 AAAAATAAGCCAATTGAGGAGGG + Exonic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1113232399 13:108227765-108227787 ACTGAAAAGGCAATTGAGACTGG + Intronic
1116533196 14:45998533-45998555 AGTGAAAAGACAATGGAGAAGGG - Intergenic
1116592533 14:46796690-46796712 AATGAAGAGCCAAATCAGAAAGG - Intergenic
1116701241 14:48245637-48245659 AATGAAAAGCCAGATGTGAATGG + Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117125910 14:52625499-52625521 AAAGAAAAGAAAATAGAGGAGGG + Intronic
1117993308 14:61455873-61455895 ACTGGAAAGCCAACTGAGGCAGG + Intronic
1121030103 14:90651005-90651027 AAAGAAAACACAATTCAGGAAGG - Intronic
1121161549 14:91746038-91746060 AATTTAAAGCCAACTGATGAGGG - Intronic
1121477297 14:94221401-94221423 AATGAAAAGACAAGTCAGAATGG + Intronic
1125346737 15:38726061-38726083 AAAAAAAACCCAAATGAGGAAGG + Intergenic
1126482279 15:49138656-49138678 TATGTAATGCCAATAGAGGAAGG - Intronic
1127213285 15:56797866-56797888 AATGAAATGCTTTTTGAGGATGG + Intronic
1128219870 15:65961487-65961509 TATGACAACCCAATTGTGGAGGG + Intronic
1128661521 15:69504660-69504682 ATTCAAAAGCCATTTGAGGGGGG + Intergenic
1129173606 15:73823233-73823255 AAAGGAAAGACAATTGAGGATGG - Intergenic
1130886247 15:88094945-88094967 ATTGAACAGCTAACTGAGGATGG + Intronic
1131906787 15:97151662-97151684 ATATAAAAGCCAATTGAAGAGGG + Intergenic
1136400913 16:30017980-30018002 AAAGAAAAGAAAATTGAGGCTGG + Intronic
1137246672 16:46711494-46711516 AATAAAAACCCAAATGAGGCTGG - Intronic
1139290125 16:65850224-65850246 AAAGAAAAGAAAATTAAGGAGGG - Intergenic
1139458857 16:67106499-67106521 AATGAAAAGCATATTCAGGGAGG - Intergenic
1139780244 16:69345385-69345407 AATAAAAAGACAATTCAGGCAGG + Intronic
1144088304 17:11830684-11830706 AATGAAAATCCAACTGAAGTTGG + Intronic
1144447964 17:15348730-15348752 AATGTACAGCCATTTGAGGTAGG - Intergenic
1145002668 17:19316277-19316299 AATTAAAAGCTATCTGAGGATGG + Intronic
1147466868 17:40617121-40617143 AATGAAGAGCCAAGTGATGGGGG - Intergenic
1148209050 17:45797172-45797194 GAAGAAAAGCCAAGTCAGGAAGG + Intronic
1151027151 17:70691108-70691130 AATGAAAAGCAAATTAGAGAAGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153160445 18:2198834-2198856 AATGAAAAGCAAATGGAAGTGGG - Intergenic
1153485875 18:5597196-5597218 AACCAAAAGGCACTTGAGGAGGG - Intronic
1153897444 18:9579436-9579458 AATGTTAAGCCATTTGGGGAAGG - Intronic
1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG + Intergenic
1155281632 18:24246386-24246408 AATGGGAAGCCAGTGGAGGAGGG + Intronic
1155457486 18:26033968-26033990 AATGAAAAGGCCATTTGGGAAGG + Intronic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1156040915 18:32821958-32821980 AAGGTAAACCAAATTGAGGAAGG - Intergenic
1156579339 18:38356794-38356816 AATGAAAAGAAAATTGTGGCCGG - Intergenic
1157250354 18:46089923-46089945 AATGATAAACTAATTAAGGAAGG - Exonic
1157730240 18:49997724-49997746 AATTAAAGGCGACTTGAGGATGG - Intronic
1159023172 18:63159694-63159716 AGTCAAAATCCAATTGAGTAGGG + Intronic
1159223744 18:65503170-65503192 AAAGAAATGCCATTTGGGGAAGG - Intergenic
1160658183 19:284751-284773 AATGAAAAATCACTTGAGGGAGG + Intronic
1162207280 19:9065471-9065493 CATGCAAGGCCATTTGAGGATGG + Intergenic
1162691536 19:12437794-12437816 AATCAAAAGCCATATGGGGATGG + Intronic
1164708357 19:30336821-30336843 AATGAAATTGCATTTGAGGATGG + Intronic
1167709396 19:51100609-51100631 AAAGAAAAGAAAATGGAGGAAGG + Intronic
1168674907 19:58270594-58270616 AATTAAAAGCCAATACAGGCCGG - Intronic
1202710068 1_KI270714v1_random:14186-14208 AATGAAAAACCACTGGAGAAGGG - Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926159680 2:10478661-10478683 AAAGAAAAGCAAATGAAGGACGG - Intergenic
926546383 2:14245541-14245563 AGTGAAAAGACAAATCAGGAGGG - Intergenic
927882448 2:26698233-26698255 AAGGAAATGCCAACTGAGGTGGG - Intronic
928309443 2:30197341-30197363 AAAGAAAAGAAAATGGAGGAAGG + Intergenic
928607539 2:32957319-32957341 AATAAAAAGCTAAGTGAGGAAGG - Intronic
929061575 2:37930437-37930459 AAGGAAAAGCCACTTGGGGAAGG - Intronic
929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG + Intergenic
931612919 2:64123277-64123299 TATGAACAGCCAATTTAGGAAGG - Intronic
931772833 2:65513472-65513494 AATGAAAATCCACGTAAGGATGG + Intergenic
931922772 2:67038658-67038680 AATGAAAAACAAATTTAGAAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933569466 2:83992427-83992449 AATGAAAATACATTTAAGGAAGG + Intergenic
933758572 2:85659655-85659677 AAGGAAAAGCCAAGTGAGACGGG - Intronic
936977228 2:118232331-118232353 AATCAAAAGCCTATTCAGGTTGG + Intergenic
937007416 2:118529979-118530001 AATGAAATGCCAAAATAGGAAGG - Intergenic
937180108 2:119987528-119987550 AATGAAAAACCATTTAAAGAAGG - Intergenic
937253518 2:120539252-120539274 AATGAAAAGCTGATAGAGGAAGG + Intergenic
937731952 2:125243445-125243467 AATGAAAGGACAATTTAAGATGG + Intergenic
938326713 2:130411060-130411082 AATGAAAAGCCAGTTGAAACTGG - Intergenic
938363231 2:130710399-130710421 AATGAAAAGCCAGTTGAAACTGG + Intergenic
939654202 2:144802453-144802475 AATAAAAAGCACATTGAGTATGG + Intergenic
940497510 2:154452083-154452105 AATAAAAAGTCAAAAGAGGAAGG - Exonic
941767740 2:169316564-169316586 AAGGAAAATCCAGTTCAGGAGGG + Intronic
943145603 2:184040874-184040896 AAGGAAAAGACAATTTAGAAAGG - Intergenic
943328888 2:186535295-186535317 AATGCAAAGGTAATGGAGGAAGG + Intergenic
943385037 2:187192326-187192348 GTTGAAAAGCCAGTTGAGAAAGG + Intergenic
943844006 2:192618214-192618236 AATGTAAATCTAATTGATGAAGG - Intergenic
944024668 2:195149152-195149174 AACGAAAACCTAATAGAGGAAGG - Intergenic
944296402 2:198067840-198067862 AATGAAAATCAAAATAAGGAGGG - Intronic
944533314 2:200685520-200685542 TGTGAAAAGCCAATTTTGGAAGG - Intergenic
944940872 2:204625050-204625072 AAACAAAAGCCAATTGAAAATGG - Intronic
947380760 2:229543322-229543344 ATTGAAAAGGCAATAGAGGTAGG - Intronic
1169780815 20:9307742-9307764 AATGAAAAAACAATTGAGGATGG - Intronic
1170443136 20:16398733-16398755 CATGTAGAGCCAATTGCGGAAGG + Intronic
1173175869 20:40764339-40764361 AAAGAAAAGCCTAATTAGGAAGG - Intergenic
1173432667 20:43004260-43004282 AATAAAAAGACAATGGATGAAGG + Intronic
1173440179 20:43068517-43068539 AAAAAAAAGCCAATTAGGGAAGG + Intronic
1173846252 20:46190527-46190549 ACTGAAAAGCCAAGAGGGGAGGG - Intronic
1174396986 20:50252852-50252874 AGTGCAATGCCAATTGGGGAAGG + Intergenic
1174665881 20:52257279-52257301 AATCAAAACCCCATTGAGGCCGG + Intergenic
1174758032 20:53179174-53179196 AATGAAATCCCTTTTGAGGAAGG - Intronic
1174875363 20:54221821-54221843 ATGGAAAAGCCATTTGAGGTAGG + Intronic
1174880294 20:54272181-54272203 AATGAACGGCCAATTGCTGAGGG + Intergenic
1174927539 20:54777164-54777186 AATGAAAAGCTATTTGAATAAGG - Intergenic
1175275064 20:57762776-57762798 ACTGAAAGGCCACCTGAGGATGG + Intergenic
1176156343 20:63623500-63623522 AATAAAAAGCCACTTTAGGCCGG + Intronic
1176523893 21:7850495-7850517 AAAGAAAATGAAATTGAGGAGGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177733318 21:25057336-25057358 AAAGAGAAGCCAATTCAGGAAGG + Intergenic
1177827431 21:26100042-26100064 AATGAAAAACAAATTGTGGGTGG + Intronic
1177964410 21:27709828-27709850 AATGATAAGTCAATTCAGCAAGG - Intergenic
1178174420 21:30079755-30079777 AACCAAAAGCCAGTTTAGGATGG - Intergenic
1178657913 21:34480507-34480529 AAAGAAAATGAAATTGAGGAGGG + Intergenic
1179116981 21:38502344-38502366 AATAAAAAGGCAGTTGGGGATGG + Intronic
1181677025 22:24461808-24461830 AAACAAAAGCCCAGTGAGGAGGG + Intergenic
1182660284 22:31920185-31920207 GATAGAAAGCCAATGGAGGAGGG - Intergenic
1182945833 22:34320671-34320693 AATGACAAGCCATTTTAGAATGG - Intergenic
1184712351 22:46259744-46259766 AATGAAAAGCACAGTGAAGAGGG + Exonic
949372035 3:3345796-3345818 AAGCAAAAGCCATTTCAGGAAGG - Intergenic
949410607 3:3759669-3759691 AATGAAACTCCAAGTTAGGAAGG + Intronic
949887523 3:8708427-8708449 AAAGAAAAGCCTATAGAGGTTGG + Intronic
949973962 3:9437095-9437117 AATGAAAAACCAATCAATGAAGG - Intronic
950110935 3:10418316-10418338 AAAGAAAAGGCTATTGAGGTAGG + Intronic
950134849 3:10573835-10573857 GAGGAAAAGCAAATTGAAGAAGG - Intronic
951174770 3:19586416-19586438 AATGGAAAGCTCCTTGAGGAGGG - Intergenic
951839107 3:27014628-27014650 TATGAAAAGTGAATTGAGGGGGG + Intergenic
953081695 3:39625689-39625711 AATGAAATGCCAAGTGTGGCTGG - Intergenic
955463988 3:59216838-59216860 AATGAATAGCCAGATGAAGAGGG - Intergenic
956054610 3:65285476-65285498 AATGAAAAGACAATATAGCAGGG + Intergenic
957141193 3:76360141-76360163 GATGAGAAGCCAATTTATGATGG + Intronic
958116688 3:89229011-89229033 AGTGAAAAGGGAAGTGAGGAAGG - Intronic
959216484 3:103456486-103456508 TATGAAAAGCCAAATGTGAAAGG + Intergenic
960189947 3:114691919-114691941 AATGAAAAGCTCCTTGGGGAAGG - Intronic
963129108 3:141841640-141841662 GCTGAGAAGGCAATTGAGGAAGG + Intergenic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
964673859 3:159255779-159255801 AATGAAAAGGCATTTGGGGGAGG + Intronic
965007264 3:163042557-163042579 AATGAAAAAATAATTGAGCATGG - Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965523125 3:169688721-169688743 AATGAATAGCAAATGGAGGGAGG - Intergenic
968561753 4:1287009-1287031 AACAAAAAGCCAATTAGGGAAGG + Intergenic
971874452 4:32288342-32288364 AATGAGAAGCTAATATAGGAGGG + Intergenic
971936495 4:33155842-33155864 AATGATAAACCAATTCAGTAAGG + Intergenic
972171667 4:36353193-36353215 AATGAAATTCCAGTTGAAGAAGG + Intergenic
972789403 4:42356754-42356776 AATTAAAACCAAATTGAGGCTGG + Intergenic
974500352 4:62692385-62692407 AATTAAAAGGCAATAGAGTAAGG - Intergenic
974622284 4:64374236-64374258 AATGGAAAGCCTATGCAGGAAGG - Intronic
974664121 4:64935950-64935972 AATGAGAAGCCAGTTTATGAGGG - Intergenic
975123834 4:70759153-70759175 AATGAAAAGAGTATGGAGGAGGG - Intronic
975183968 4:71379569-71379591 AATGATAAGTCAATGGGGGAAGG - Intronic
975990993 4:80260016-80260038 AATGAAAAGCAAATGGACCAAGG + Intergenic
976114704 4:81714514-81714536 ATTGAAAAGTTAATTGAAGACGG - Intronic
976354294 4:84098151-84098173 AAGAAAAAGGCAATTGAAGATGG + Intergenic
977636163 4:99300910-99300932 AATGAAATGCTAATTGAGTAGGG - Intergenic
978717414 4:111862800-111862822 AATAAAAAGCCAAATGTTGATGG + Intergenic
979046693 4:115874634-115874656 AATCATAAGTCAATTGAAGATGG - Intergenic
979213416 4:118133484-118133506 AATGAAAATGGCATTGAGGAGGG - Intronic
979481061 4:121218382-121218404 TAGGAAAAGGCAATTTAGGAAGG - Intronic
979714033 4:123815227-123815249 TATGAAAAACCAATTAAGAAGGG - Intergenic
981078189 4:140611906-140611928 AAAAAAAAGACAATTGATGAAGG - Intergenic
981336373 4:143573292-143573314 AATGAACAGCCAGATGAAGAGGG - Intergenic
981364866 4:143890832-143890854 AATTAAATGCGAATTGAGGGAGG - Intronic
981385984 4:144131305-144131327 AATTAAATGCGAATTGAGGGAGG - Intronic
981505115 4:145491270-145491292 AATGAAATGCCAACTGCTGACGG + Intronic
981562292 4:146061269-146061291 AAAGAAAAGCCAAGAAAGGAAGG - Intergenic
981819020 4:148864605-148864627 AATGAATAGACAGTTGAAGAAGG + Intergenic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983828204 4:172291649-172291671 AAGGCAAAGGCAATTGATGAGGG + Intronic
984158127 4:176217084-176217106 AAAGGAAAGGCAATAGAGGAAGG + Intronic
985870734 5:2554046-2554068 AATCAAAATCAAATTCAGGAAGG + Intergenic
986077631 5:4354339-4354361 ACCGAAAAGCCAATAGAGGGAGG - Intergenic
986632039 5:9783111-9783133 ATTCAAAAGCCAATAGAGTAAGG - Intergenic
986634453 5:9807240-9807262 AATGAAAAGATAATAGATGATGG + Intergenic
986823913 5:11499819-11499841 AATAAAAAGAGAATTTAGGAAGG - Intronic
987192409 5:15491844-15491866 AATGCAAATCCAATGGAGGAGGG - Intergenic
987561795 5:19533182-19533204 AAAGAAGAGCCAATGAAGGATGG + Intronic
987590481 5:19919227-19919249 AATGAACAGCCAGATGAAGAGGG - Intronic
987896078 5:23949202-23949224 ACAGAAAAGCCAATGGAGGCTGG + Intergenic
988046017 5:25954407-25954429 AATGAAAGGGCAGTTGAAGAGGG + Intergenic
988088807 5:26508244-26508266 AAAAAAAAGCCAATTAGGGAAGG - Intergenic
989055899 5:37366425-37366447 AATAAAAAGATAATTGGGGAAGG - Intronic
990146245 5:52763581-52763603 AATGAAAAGCCAAGTGAAAGGGG - Intergenic
990794319 5:59522992-59523014 AATTATAAGCTAATTGAGCAGGG - Intronic
992006909 5:72487190-72487212 AATAAAATGCCAGTTTAGGAAGG - Intronic
992229382 5:74648993-74649015 AATGAAAAACCAATTATAGAAGG + Intronic
993234783 5:85290501-85290523 AAAGAAAAGCCAGTGGAGAAAGG + Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993757399 5:91749026-91749048 AATGAAAAGCAAATAAAGCAGGG - Intergenic
993778333 5:92031318-92031340 AATGCAAAGCAAATTGTGGAAGG - Intergenic
994840169 5:104913780-104913802 AAAGAAAAGAAAATGGAGGAGGG + Intergenic
994890396 5:105626326-105626348 AATGAACAGACAATTGAAAAGGG - Intergenic
994951693 5:106471849-106471871 AATGAAAATCCAAGTGAGTTGGG - Intergenic
995667430 5:114558629-114558651 AATGAAAAGACAAGAGAGGGTGG + Intergenic
998032874 5:138888008-138888030 CAAGAAATGGCAATTGAGGAAGG - Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
1000563106 5:162814731-162814753 AAGGATAAGCCAATTTAAGATGG - Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000767577 5:165310736-165310758 AATGCAAATCCAACTGAAGATGG - Intergenic
1001669744 5:173463775-173463797 AAAGAAAAGCCAATTCAAAACGG - Intergenic
1002112919 5:176932274-176932296 AATGCAAAGACATTTAAGGAAGG - Intronic
1002475638 5:179464078-179464100 AAAGACAAGCCAATTAAGAATGG - Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004376212 6:15092901-15092923 AATGAAAAGCCAAAGGAACAGGG - Intergenic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1005257712 6:24021950-24021972 AATGACTAGCCATTTGAGTAGGG - Intergenic
1006665145 6:35688445-35688467 AAACAAAAGCCCAGTGAGGACGG + Intronic
1007017240 6:38481077-38481099 AATGGAAATCCCATTGAGTAGGG + Intronic
1007548127 6:42709416-42709438 AATGAAAGGTCAAGTCAGGAGGG - Intronic
1008826408 6:55699657-55699679 AAAGAAGACCCATTTGAGGATGG + Intergenic
1009319206 6:62265537-62265559 AAGTTAAAGCTAATTGAGGAAGG + Intronic
1010799748 6:80161724-80161746 AATGAAAAGCTGATGTAGGATGG - Intronic
1011496695 6:87943660-87943682 AATGAAAGGTCAATGAAGGAAGG + Intergenic
1011781901 6:90799038-90799060 AATGGAAAGAAAATGGAGGATGG - Intergenic
1011944806 6:92887689-92887711 TAAGAAAAGCCACTTGAGGCCGG - Intergenic
1012036457 6:94147518-94147540 AATCAAAGACCCATTGAGGATGG + Intergenic
1012353215 6:98279058-98279080 CAGGAAAAGCCAATAGAGAAGGG - Intergenic
1013005940 6:106073409-106073431 AATCAAAAGGAAATTGAGGCCGG - Intergenic
1013032479 6:106348055-106348077 AATGGTAAGCTACTTGAGGATGG + Intergenic
1014293186 6:119584961-119584983 AATGAAGAGGCCATGGAGGAGGG + Intergenic
1014316738 6:119876269-119876291 CAAGAACAGCCAAATGAGGAAGG - Intergenic
1014742785 6:125166156-125166178 AAGAAAAAGCCAATTTGGGATGG + Intronic
1014811927 6:125896443-125896465 AAGGTAAGGCCAATTGAGGCCGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018161293 6:161045263-161045285 AAGGAAAAGCAAATTGGGAAAGG - Intronic
1019844896 7:3488640-3488662 AATGAAAAACCAACTGAAAATGG + Intronic
1019854028 7:3586356-3586378 AATTCACAGCAAATTGAGGAGGG + Intronic
1020585556 7:10061257-10061279 AAGGAAAAGGCAATTGTGGCTGG - Intergenic
1022592625 7:31680366-31680388 AATGCAGAGCCAACTGGGGAAGG + Intergenic
1023674857 7:42618432-42618454 AATGCAATGCCATTGGAGGATGG + Intergenic
1023936166 7:44741257-44741279 AATAAAAACCAATTTGAGGATGG - Intergenic
1024472593 7:49778350-49778372 AATGAAACGTCATTTGAAGATGG - Intronic
1025021107 7:55480986-55481008 AATGAAAAGCCAACAGGGGAGGG + Intronic
1026565535 7:71487007-71487029 ACTGAAAAGTCAAGGGAGGAGGG - Intronic
1026879311 7:73898691-73898713 TAAGAAAAGCCAACTGAGGCCGG - Intergenic
1027769764 7:82392165-82392187 CATGAAAAACCAATTAGGGAAGG - Intronic
1029200586 7:98836656-98836678 AATAAAAATCCAGTTGAGGCCGG - Intergenic
1029912818 7:104173375-104173397 AATGATAATCTATTTGAGGATGG - Intronic
1031116493 7:117674551-117674573 AATGAAAAGGCAAAGGAGAAGGG - Intronic
1032956873 7:136982267-136982289 AATGAAAAGCAAAATAAGTAGGG - Intronic
1035046316 7:155969648-155969670 AATGAAGAGCCATTTGACAAGGG + Intergenic
1036728579 8:11242014-11242036 AAGGAAAGGCCATGTGAGGATGG + Intergenic
1039437691 8:37571670-37571692 AATGTAAACCCAATGAAGGAAGG - Intergenic
1040722545 8:50343981-50344003 AGAGAAAAGCCAGCTGAGGATGG - Intronic
1040773194 8:51004743-51004765 AATTGAAAGCCAAATGAAGAAGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1043118775 8:76294620-76294642 AAAGAAAAGCCTATTTATGAAGG + Intergenic
1043172465 8:76982438-76982460 AATATAAAGCCAACTGTGGAGGG + Exonic
1043448326 8:80340857-80340879 AATGAAAAGAGAATTGAGCCAGG - Intergenic
1044357188 8:91236228-91236250 AATGAAAAGCAATTTGAGGCTGG + Intronic
1045608718 8:103809726-103809748 ATTATAAAGCCACTTGAGGATGG - Intronic
1046008916 8:108521891-108521913 AATGAAAAGTGAATGGAGAAAGG - Intergenic
1046196939 8:110877711-110877733 AAAGAAAAACAAATTGAGGCAGG + Intergenic
1046372807 8:113332413-113332435 AATGAAAAACAAATTCAGCAAGG + Intronic
1046741037 8:117829306-117829328 AAAAAAAAGCAACTTGAGGACGG + Intronic
1046810363 8:118526575-118526597 AATGAAAAGACTATTTAGAAAGG + Intronic
1046860965 8:119091251-119091273 AATTCAAAGCAAATTGAGGCCGG + Intronic
1047039020 8:120971881-120971903 AATGAAAAGCAAATAGAGCAAGG - Intergenic
1047253065 8:123195075-123195097 AATGAGAGAGCAATTGAGGAAGG + Intronic
1047513298 8:125531812-125531834 AATGAACAGCCAGATGAAGAGGG + Intergenic
1048371142 8:133777247-133777269 AATGAACAGACAATTGAAAATGG - Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1050210448 9:3248544-3248566 AGTGAAAATCCTATTGATGAAGG + Intronic
1052182271 9:25544274-25544296 AAAAAAAAGCAAATTCAGGAAGG + Intergenic
1052981752 9:34455283-34455305 AATGGAAAAACAATCGAGGAAGG + Intronic
1053108122 9:35431247-35431269 AATGAAAAGACAACTCAGAATGG + Intergenic
1055001314 9:71452242-71452264 AATCAAAGGACAAATGAGGAGGG + Intergenic
1055415983 9:76083662-76083684 ATTGAAAAGGCATTTGATGATGG - Intronic
1057449615 9:95145235-95145257 AATGAAAATCTATTTGAAGATGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058002694 9:99882369-99882391 ACTCAAAAGCCAAATGAGTAAGG + Intergenic
1058113558 9:101058198-101058220 ACAGCAAAGCCATTTGAGGAGGG - Intronic
1058422951 9:104850494-104850516 AATGAAAAGATAAAAGAGGAAGG + Intronic
1058506705 9:105673987-105674009 AAAGAAAATCCAAAAGAGGAAGG + Intergenic
1059160836 9:112033894-112033916 AATGAAAAGCCACTTCTGGAGGG - Intergenic
1059478651 9:114570634-114570656 AATGAAAAGCCACTAGGGGCTGG - Intergenic
1186775958 X:12864822-12864844 AATAAAAAGACAAATGAGGTTGG + Intergenic
1187001043 X:15178776-15178798 AATGAAGGGGAAATTGAGGAGGG - Intergenic
1188314887 X:28661130-28661152 AAATAAAATTCAATTGAGGAAGG + Intronic
1188580560 X:31707172-31707194 AATGAAGAGGCTATTTAGGAAGG - Intronic
1188782700 X:34305341-34305363 AATGAAAAGACACTAGAGCAAGG + Intergenic
1188847767 X:35095092-35095114 AATGATAAGCAAGTTGAGCAAGG + Intergenic
1188947758 X:36328512-36328534 AAAGAAAAGCAAATTGGGGCCGG + Intronic
1189619374 X:42819043-42819065 TGTAAAAAGCCAATTAAGGAAGG + Intergenic
1190795934 X:53742068-53742090 TATGACAAGCCAGTTGGGGAGGG - Intergenic
1191865687 X:65701993-65702015 AAAAAAAAGCCAATTGAATACGG - Intronic
1191940332 X:66473004-66473026 AATGAAAAAGCTATTAAGGAAGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197080804 X:122413065-122413087 TATGGAAATACAATTGAGGAAGG - Intergenic
1197734578 X:129841322-129841344 AGTGAAAAGCCAACTGAGTTGGG - Intronic
1198046950 X:132912932-132912954 TATAAAAAGCCAATTAGGGAAGG - Intronic
1198635952 X:138700550-138700572 AATGAAGTGCCCACTGAGGATGG + Intronic
1199333556 X:146590294-146590316 AATGAATAACCAAATGAGAATGG - Intergenic
1199663812 X:150080951-150080973 AAGGAAAAGACAGTAGAGGAAGG - Intergenic
1200018862 X:153185213-153185235 AATGAAACACCATTTGAGGCTGG + Intergenic