ID: 1112314337

View in Genome Browser
Species Human (GRCh38)
Location 13:98348043-98348065
Sequence AGGATGTGAAGGAGTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112314331_1112314337 2 Left 1112314331 13:98348018-98348040 CCAAGTCAGAGCCTTATTCATAG 0: 1
1: 0
2: 1
3: 8
4: 186
Right 1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG 0: 1
1: 0
2: 2
3: 24
4: 275
1112314330_1112314337 3 Left 1112314330 13:98348017-98348039 CCCAAGTCAGAGCCTTATTCATA 0: 1
1: 0
2: 0
3: 14
4: 234
Right 1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG 0: 1
1: 0
2: 2
3: 24
4: 275
1112314333_1112314337 -9 Left 1112314333 13:98348029-98348051 CCTTATTCATAGTAAGGATGTGA 0: 1
1: 1
2: 1
3: 6
4: 166
Right 1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG 0: 1
1: 0
2: 2
3: 24
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112314337 Original CRISPR AGGATGTGAAGGAGTTTAAG GGG Intronic
900755471 1:4431393-4431415 TGGAAGTGGGGGAGTTTAAGTGG + Intergenic
902306600 1:15544607-15544629 TGGCTGAGAAGTAGTTTAAGAGG + Intronic
902689084 1:18098520-18098542 AGCCAGTGAAGGATTTTAAGGGG + Intergenic
902711198 1:18241139-18241161 AGGATGTGAACGAATTTTATAGG + Intronic
904265259 1:29315004-29315026 AGGATGTGTAGGAGATTTGGTGG + Intronic
905161918 1:36044041-36044063 AGCATGTGAAAGAGTTTAATTGG + Intronic
905169441 1:36100444-36100466 AGGGTCTGAAGAAGTTTAGGAGG - Intronic
905677355 1:39836773-39836795 AGGATGTGCAGGAGTTCACTAGG + Intergenic
906007685 1:42491448-42491470 AGGATGGGAAGGAGAATAAAGGG + Intronic
906949794 1:50325281-50325303 AGAATGTGCAGGAGTTTGTGTGG - Intergenic
907475944 1:54705578-54705600 AGGATGAGAGGGAATTTATGAGG + Intronic
907598681 1:55745114-55745136 AAGATGTGAGGGCCTTTAAGAGG - Intergenic
907927745 1:58970321-58970343 GGGATGGGAAGGATTTAAAGAGG - Intergenic
908332581 1:63085110-63085132 AGGATGGGAAGGACATAAAGAGG - Intergenic
908709226 1:66996189-66996211 ATGATGGAAAGCAGTTTAAGAGG - Intergenic
910317161 1:85899340-85899362 AGGTTGTAAAGGAGTTTTAAGGG - Intronic
910963697 1:92786733-92786755 AGAATGGGAAAGTGTTTAAGTGG - Intronic
910981755 1:92965210-92965232 AGGATGTCATGGTGGTTAAGGGG - Intergenic
912622022 1:111171106-111171128 GGGATGTGAAGGGATTTAAATGG - Intronic
913167213 1:116199429-116199451 AGGATGTGAAGGACTTAAAGTGG - Intergenic
913995010 1:143644387-143644409 AGAATGGGAAGGTGCTTAAGTGG - Intergenic
914491435 1:148152988-148153010 AGAACGGGAAGGTGTTTAAGTGG - Intergenic
914708098 1:150188024-150188046 AGGAAGTGAAGAGGTCTAAGAGG - Intergenic
916476586 1:165175171-165175193 AGGATCTGAAGAAGTGCAAGAGG - Intergenic
916660425 1:166918400-166918422 AGAATGAGAAGGAATTTAAAAGG - Exonic
916831636 1:168498194-168498216 AGCCTGTGAAGGACATTAAGAGG - Intergenic
917601315 1:176577192-176577214 AGAATCTAAAGGAGTTGAAGAGG - Intronic
918178358 1:182065035-182065057 AGGATGTGATGAAGATTAATTGG - Intergenic
919434817 1:197544861-197544883 AGGAGGAGAAGGAGATGAAGAGG + Intronic
919621242 1:199866518-199866540 CGGAAGTGAAGGAGATTAAATGG - Intergenic
920006371 1:202836477-202836499 AGGATGTGATGGGGTGAAAGAGG - Intergenic
920107697 1:203565962-203565984 AGGATGGCAAGCAGTTGAAGGGG - Intergenic
920116958 1:203628283-203628305 GGGAGGTGGAGGAGTGTAAGAGG - Intronic
920579372 1:207090521-207090543 AGGATGTGAAGGAGTAAAACAGG - Intronic
921301156 1:213752840-213752862 AGCAGGGGAAGGAGTCTAAGTGG - Intergenic
921839816 1:219816399-219816421 AGGATGAAAAGGAGTGCAAGAGG - Intronic
922450246 1:225731557-225731579 AGGATGAGAATGAGTTCAGGAGG - Intergenic
923928917 1:238670477-238670499 AGGATATGAAGATGTTTTAGAGG - Intergenic
924102100 1:240614920-240614942 AGGATGGGAATAAGTTGAAGTGG + Intergenic
924465141 1:244292705-244292727 AAGATGGGAAGGAGTGGAAGGGG + Intergenic
1065991731 10:31016972-31016994 CGGATGTGAATGAGTTGAAGAGG - Intronic
1066496779 10:35949848-35949870 AGAATGTGAAGGTGTTAAAAAGG - Intergenic
1069034524 10:63632673-63632695 AGGAGGGGAAGGACTTTGAGAGG + Intergenic
1071952277 10:90717395-90717417 AGGATCTGCAGGAGTTTAATGGG + Intergenic
1073923615 10:108487527-108487549 AGGATGTGAAGCCACTTAAGAGG + Intergenic
1074847353 10:117410092-117410114 AGGGTGAGTAGGTGTTTAAGTGG + Intergenic
1076525241 10:131108580-131108602 AAGATGTGAAGGAGATTCACTGG - Intronic
1083387662 11:62323760-62323782 AGGTTGAGCAGGAGTTTTAGAGG + Intergenic
1084901023 11:72310028-72310050 AGGATGGGCAGGATTTGAAGAGG + Intronic
1088566750 11:111180635-111180657 AAGATGTGAAGAAGTTCATGGGG - Intergenic
1088635729 11:111818534-111818556 AGGATGAGTAGGAATTTATGAGG - Intronic
1089717159 11:120371587-120371609 AGGATGTGAAATGGTTTAAAGGG + Intronic
1089747791 11:120629143-120629165 AGGATGGGAAGAAGTTGGAGAGG + Intronic
1089936651 11:122371096-122371118 AGGGTGAGAAGGCATTTAAGGGG + Intergenic
1090082986 11:123626724-123626746 AGGATGTCAAGGATGTCAAGTGG - Intronic
1090224352 11:125061146-125061168 AGGATCTGAAGGAAATAAAGAGG - Intergenic
1090465289 11:126928189-126928211 AGGATGTGCAGGAGTTTGCTAGG + Intronic
1091999437 12:5020288-5020310 AGGATGTGCAGGAGTTTGTCAGG - Intergenic
1093406894 12:18815031-18815053 AGGATGGGGAGGAGAGTAAGAGG + Intergenic
1095538728 12:43283168-43283190 AGGATGTGAAGGATTTATGGTGG - Intergenic
1095733818 12:45535191-45535213 AGGATGAGAAGAAGTTTATTAGG + Intergenic
1097455056 12:59790132-59790154 AGGCTGGGAAGGGGTTTGAGGGG - Intergenic
1098278613 12:68839599-68839621 AAGATGTGAAAGAGTTTGAAAGG + Exonic
1098830411 12:75354585-75354607 AGAATGTCAATGAGTTTAATGGG - Intronic
1099048729 12:77757093-77757115 AGGATGAAAAAGACTTTAAGAGG - Intergenic
1099109022 12:78533539-78533561 AGGATATCAAGGAATTTAAAAGG + Intergenic
1099153464 12:79144661-79144683 AGGGTGTGAAGAGGTTTGAGAGG - Intronic
1099944507 12:89228665-89228687 AGACTGTGAAGGAATTTGAGAGG + Intergenic
1101435280 12:104659017-104659039 AAGATGTGAAGGGCTTCAAGTGG - Intronic
1103742283 12:123098948-123098970 AGGATATGGAGGAGTTTATCAGG - Intronic
1106022224 13:25926330-25926352 AAGATGTGTAGGAGTTGATGTGG - Intronic
1107752451 13:43583091-43583113 ATGCTTTGAAGGAGTTTAAATGG - Intronic
1108003907 13:45928613-45928635 AGAATGAGAAGGTGTTTAAGAGG + Intergenic
1108711306 13:53035113-53035135 AGGATTTGAAGGAGTGGAAGTGG - Intronic
1109201773 13:59439597-59439619 AGGATTTTAAAGTGTTTAAGAGG + Intergenic
1109686892 13:65832031-65832053 GGGAGTAGAAGGAGTTTAAGTGG + Intergenic
1110252505 13:73396439-73396461 AGGATGAGAAGGAGTGAAAAAGG + Intergenic
1110689226 13:78412554-78412576 AGGATGTGATGGAATTTGGGTGG + Intergenic
1110829163 13:80010823-80010845 AGGATGAGTAGGTGTTTAGGGGG - Intergenic
1111298581 13:86316716-86316738 AGCATATGCAGGAGTTTAACTGG + Intergenic
1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG + Intronic
1112884434 13:104151307-104151329 AAGATCTGAAGGAGTTGCAGTGG - Intergenic
1113507229 13:110825672-110825694 TGGATGAGAAGGAGCTTGAGGGG - Intergenic
1115249238 14:31329011-31329033 AGCATGTGAAGGAGGCAAAGGGG + Intronic
1115627771 14:35211943-35211965 AGCAAGTGAAAGGGTTTAAGAGG - Intronic
1118850043 14:69576172-69576194 AGAAAGTGAAGGGTTTTAAGTGG + Intergenic
1120057515 14:79942249-79942271 AGGGAGTGAAGGAGTTTGAGTGG + Intergenic
1121576656 14:94994412-94994434 AGGATGAATAGGAGTTCAAGTGG - Intergenic
1121610202 14:95273415-95273437 AGAAGGAGAAGGAGTTTATGAGG + Intronic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1124157888 15:27244078-27244100 TGGATGTGAAGACATTTAAGAGG + Intronic
1125135274 15:36334010-36334032 AGGATGTGAGAGAGTTTTAAAGG - Intergenic
1125358791 15:38844422-38844444 AGGATGTGCAGGATTATCAGTGG - Intergenic
1126232381 15:46342252-46342274 AGAATGTGTAAGAGGTTAAGGGG - Intergenic
1126583915 15:50264790-50264812 AGGATGTGAGAGGGTTGAAGGGG - Intronic
1127395868 15:58543514-58543536 AGGATGAGGAGGAGTTTGAGTGG - Intronic
1127596057 15:60483227-60483249 AGGATGTGTAGGAGTTCACTGGG + Intergenic
1128262782 15:66244036-66244058 AGGATGTTAAAGAGTTCAAGTGG - Intronic
1128885097 15:71279490-71279512 AGGATGCGAAGGAGTAGAACTGG + Intronic
1130358360 15:83156324-83156346 AGGGTGTGAAGGAATTGAATGGG - Intronic
1132196847 15:99919879-99919901 TGGATGTGATGGGGATTAAGAGG - Intergenic
1134739218 16:16527703-16527725 AAGATATGAACGAGGTTAAGAGG - Intergenic
1134928282 16:18184448-18184470 AAGATATGAACGAGGTTAAGAGG + Intergenic
1135154922 16:20044496-20044518 AAGATGAGTAGGAGTTTAACAGG + Intronic
1135721489 16:24821976-24821998 AGGAAGTGAAGGAAGTCAAGAGG + Intronic
1136111508 16:28066417-28066439 AGGATTTGAAGGAGATGTAGGGG + Intergenic
1136856747 16:33665380-33665402 AGGATCTGAAGGGGTTGAGGAGG - Intergenic
1137831798 16:51550821-51550843 AGGATGTGTAGGTGTTTAGTAGG + Intergenic
1138110431 16:54319529-54319551 AGGAAGAGAAGGAGTTTACTGGG + Intergenic
1138847199 16:60580641-60580663 AGCATCAGAAGGAATTTAAGAGG - Intergenic
1139894910 16:70280739-70280761 AGTTTATAAAGGAGTTTAAGAGG - Intronic
1140393254 16:74606648-74606670 AGGATGTGAGGGAGGTGAGGAGG - Exonic
1140484436 16:75282645-75282667 AGGATGTGCAGGAGTCTTACTGG - Intergenic
1143015101 17:3887474-3887496 AGGAGGTGAAGGAGGTGAGGAGG + Intronic
1146005384 17:29157387-29157409 AGGATGACAAGGAGGTGAAGAGG + Intronic
1147030606 17:37631990-37632012 AGGAAGTGAAGGATTTTAACAGG + Intronic
1147041829 17:37725446-37725468 AGGATATTAATGAGATTAAGAGG - Intronic
1147142655 17:38468094-38468116 AGGATGAGAAGGAGTTTATCAGG + Intronic
1148273913 17:46285917-46285939 AGGATGATGAGGAGTTGAAGAGG - Intronic
1148636981 17:49156472-49156494 AGGATGTGCAGGAGTCCATGAGG + Intronic
1150091958 17:62334275-62334297 AGGATGAGAAGAAGCCTAAGTGG + Intergenic
1150409139 17:64928668-64928690 AGGATGATGAGGAGTTGAAGAGG + Intergenic
1151369295 17:73637801-73637823 ATGATGTGAAGGAAATTGAGAGG - Intronic
1153054255 18:929961-929983 AGAAAGTGAAAGAGTTTCAGAGG - Intergenic
1153473038 18:5468160-5468182 AGCATGGGAAGGAGGCTAAGGGG + Intronic
1153580755 18:6571203-6571225 TGGATGTGAAGGTTTTTCAGAGG + Intronic
1153811253 18:8753811-8753833 AAGCTGTGTAGGAGTGTAAGAGG + Intronic
1154206345 18:12340289-12340311 AGGATGTGTATGACTTTAGGTGG - Exonic
1155087086 18:22469164-22469186 AGGACGTGACGGAGTCTGAGAGG + Intergenic
1156373619 18:36492889-36492911 AGGATGTGAGTGAGTTTCAGTGG + Intronic
1157046684 18:44108593-44108615 AGGATGTGGAGGAGGTGAAAGGG - Intergenic
1157873147 18:51248560-51248582 AGCATGTGAAGGAAGTGAAGGGG + Intergenic
1159072956 18:63646504-63646526 AGTCTCTGAATGAGTTTAAGAGG + Intronic
1159703435 18:71657810-71657832 AGAATTTGAAGCAGTTTAAAGGG + Intergenic
1161124284 19:2547082-2547104 AGGATGTGTAGGAGTTTTCTGGG - Intronic
1161215840 19:3094689-3094711 ATGAGGTGAAGGAGTCCAAGCGG + Exonic
1161268138 19:3374673-3374695 GGGATGTGTAGGAGTTTGGGAGG + Intronic
1161347431 19:3775276-3775298 AGGGTGTGCAGGGCTTTAAGGGG + Intergenic
1161635714 19:5387661-5387683 AGGATGTATAGGAGTTTGTGAGG + Intergenic
1162370976 19:10279144-10279166 AGGATGTGTAGGAGTTCATAAGG + Intronic
1163831467 19:19549110-19549132 AGGATGTGTAGGAGTTTGCTGGG + Intergenic
1166069252 19:40377749-40377771 AGGATGGGAAGGAGTGTGAGAGG - Intronic
1168443771 19:56394131-56394153 AAGATGTAAAGGAGTTTTATGGG + Intergenic
927188598 2:20500242-20500264 AGGATGCGAAGGATTTTAACAGG + Intergenic
928870847 2:35976825-35976847 AGGATGTGGAGGAGTTTGTCAGG - Intergenic
931046276 2:58357520-58357542 TGCATGTGAAGGAGGGTAAGTGG + Intergenic
932474710 2:71995673-71995695 AGTATCTGAAGGGTTTTAAGGGG + Intergenic
933179001 2:79208960-79208982 TGGATGTGAAGGAGATGAAATGG + Intronic
933642828 2:84782554-84782576 AGGAAGTGAAGGGCTTTTAGGGG - Intronic
933783077 2:85815124-85815146 AGGATCTGGAGCAATTTAAGGGG - Intergenic
934699049 2:96423892-96423914 AGGAGGGGGAGGAGTTTAAAGGG - Intergenic
936043709 2:109170110-109170132 AGGCTATGAAGGTGTTTTAGAGG + Intronic
936111594 2:109670163-109670185 AGAATGTGAAGGATGCTAAGGGG - Intergenic
936624896 2:114138156-114138178 AGAATGTGAGTGAGATTAAGGGG - Intergenic
937492327 2:122382911-122382933 ACGATGTGAATAAGGTTAAGAGG - Intergenic
939066934 2:137494895-137494917 AGCATGTGTAGGAGTTACAGAGG - Intronic
940688487 2:156884332-156884354 AGGAAGTGAAGTAGTTTTAAAGG - Intergenic
941041909 2:160632837-160632859 AGGAAGTGGAGGAGTCTAATTGG + Intergenic
941712393 2:168727936-168727958 AGGATGTGAAAGAGGTTAGATGG + Intronic
942801881 2:179884586-179884608 ATGATGAGAAGGACTTTAATGGG + Intergenic
944822119 2:203441318-203441340 AGGCTGTGAAGCAGTGTAGGGGG + Exonic
945372574 2:209037615-209037637 AGTCTGTGAACAAGTTTAAGAGG - Intergenic
945624905 2:212190712-212190734 AGGATGTGAAATAGATTAACAGG - Intronic
945690341 2:213026221-213026243 GGGATGTGGAGGATTTCAAGAGG - Intronic
946675927 2:222159184-222159206 AGGATGTGAAGGATTTACTGTGG + Intergenic
948141569 2:235676507-235676529 AGGATCTGTAGGAGTTTACCAGG + Intronic
1168846557 20:949095-949117 AGCGTGTGAAGGAGGTGAAGGGG + Intergenic
1169324530 20:4664580-4664602 AGTATGTGAAGGATTTTACTGGG + Intergenic
1171320815 20:24242532-24242554 AGGATGTGAAAAAGTTTTAGTGG - Intergenic
1173163794 20:40671839-40671861 AGGATGGGAAGGATGTTAGGAGG + Intergenic
1173833077 20:46105173-46105195 AGGAGGAGTAGGAGTTAAAGAGG - Intergenic
1175350676 20:58315747-58315769 AGGATGGGAAGGAGTCCCAGAGG - Intronic
1177712804 21:24802059-24802081 AAGATGTGAAGCACTTTATGAGG + Intergenic
1178163771 21:29948538-29948560 AGGAGGAGAAGGAGTAGAAGAGG - Intergenic
1179048069 21:37864603-37864625 AAGATGTGCAGGGGTTTCAGAGG + Intronic
1180674721 22:17579449-17579471 GGGATGGAAAGGATTTTAAGAGG - Intronic
1181967537 22:26667515-26667537 GGGATGGGAAGGACTTTCAGAGG - Intergenic
1182711203 22:32324533-32324555 AGGATGTGTAGGAGTTTTCTAGG - Intergenic
1183093223 22:35537727-35537749 AGAATGTGTAGGAGTTTGATGGG + Intergenic
1184398729 22:44261336-44261358 AGGATGTGTAGGAGTTTTCTAGG - Intronic
1184592451 22:45494128-45494150 AGGATGAGTAGGAGTTAAAGAGG - Intergenic
1184928409 22:47660809-47660831 AGGAAGAGGAGGAGTTGAAGGGG - Intergenic
949382671 3:3463732-3463754 AGAATGAGAAGGATTTTGAGGGG - Intergenic
950053712 3:10009935-10009957 AGGTTGTGAAGGCCTCTAAGTGG + Intronic
950305353 3:11912223-11912245 AGGTTGTGAAGGCCTCTAAGTGG + Intergenic
951680239 3:25287095-25287117 AGAATGTGAATTAGTTTATGTGG - Intronic
954283498 3:49601340-49601362 AGGTTGTGCAGGAGTTAAGGAGG + Intronic
956656412 3:71557462-71557484 ATGAGGTGAAGGAGTTTTGGAGG - Intronic
960059515 3:113306152-113306174 AGGATGTGTAGCATTTTGAGAGG + Intronic
961785161 3:129343188-129343210 AGGTTGTGAAGGCCTCTAAGTGG + Intergenic
962270722 3:133976181-133976203 GGGATGTGAAGGTGTGTGAGAGG + Intronic
962600069 3:136984848-136984870 AGGATCTGGGGGAGATTAAGGGG + Intronic
963324395 3:143845678-143845700 AGGATGTCAAAGAATTTTAGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965451596 3:168845478-168845500 AGGATGAGAAGGAGAAGAAGAGG - Intergenic
966123660 3:176550220-176550242 AGGATGAGTAGGAGTTAATGAGG - Intergenic
967420140 3:189263305-189263327 AGGAGATGAAGGGGTTTATGGGG + Intronic
967995530 3:195163574-195163596 AGCATGGGAAGGAGTTTTATGGG - Intronic
969082320 4:4628281-4628303 AGGATGAGTAGGAGTTTATCAGG - Intergenic
969606982 4:8206684-8206706 AGGAGGTGAAGGAGCTGATGAGG - Intronic
970158474 4:13165492-13165514 AGGATTTGAAGGAGTTCTAGGGG + Intergenic
970348955 4:15181662-15181684 AGGATGTGATGAAGATAAAGAGG + Intergenic
970966090 4:21929761-21929783 AGGAGTTGAAGCAATTTAAGTGG - Intronic
971956196 4:33422143-33422165 AGTATTTTAAGGATTTTAAGAGG + Intergenic
972615187 4:40691210-40691232 AGCTGGGGAAGGAGTTTAAGAGG + Intergenic
972873965 4:43335028-43335050 AGCGTGTGTTGGAGTTTAAGTGG - Intergenic
974412272 4:61556765-61556787 AGGATTTGAAGGAGTTATTGAGG + Intronic
976426386 4:84907941-84907963 AGGAGGAGAAGCTGTTTAAGGGG + Intronic
976466556 4:85376113-85376135 AGGAGGTGAATGAGGTTTAGGGG - Intergenic
976882585 4:89946922-89946944 TGGACAGGAAGGAGTTTAAGAGG + Intronic
977105825 4:92883099-92883121 AGGCAGTGATGGAGTTTGAGAGG - Intronic
979191779 4:117869666-117869688 AGGAGGTGAAGTATTTAAAGTGG + Intergenic
979990730 4:127372184-127372206 AGGATGAGTAGGAGTTTAAGAGG - Intergenic
980179352 4:129385259-129385281 TCAATGTGATGGAGTTTAAGAGG + Intergenic
981733157 4:147921263-147921285 AGGATGTCAAGGAAATTGAGAGG + Intronic
982978977 4:162106292-162106314 AGCATTTTAAGGACTTTAAGTGG + Intronic
983833803 4:172365020-172365042 AGGATGTGTAACAGTTAAAGAGG + Intronic
984157551 4:176210281-176210303 AGCATGTGATGGCCTTTAAGGGG + Intergenic
984653438 4:182292884-182292906 AGGATGTGGAGGAGTTAACTAGG + Intronic
985149399 4:186930493-186930515 AGGATGAGAAGGAGAAGAAGGGG - Intergenic
985425958 4:189830101-189830123 AGGCTGGGAAGGACTTTATGGGG + Intergenic
988383469 5:30530401-30530423 AGTATGCGGAGGAATTTAAGTGG - Intergenic
989732068 5:44661149-44661171 AGGAGGTGATTGAGTATAAGAGG + Intergenic
990494981 5:56338233-56338255 AGGAGGAGAAGGAGTAGAAGAGG - Intergenic
990644723 5:57831334-57831356 AGGATGTCAAGCAGTGTGAGTGG + Intergenic
991034714 5:62117369-62117391 AGAATTTGAAGGAATTCAAGAGG - Intergenic
993363778 5:87010343-87010365 TGGTTTTGAAAGAGTTTAAGAGG - Intergenic
993816122 5:92547645-92547667 AGGATCTGAAGGATTTTTAAAGG - Intergenic
996179184 5:120398585-120398607 AAGATGTGATGGTTTTTAAGGGG + Intergenic
996531409 5:124531000-124531022 AGGATGTGAAGGGATTTCATAGG - Intergenic
998059532 5:139108851-139108873 AGGATGTGAAGGAGGGGAAAAGG + Intronic
998550230 5:143070238-143070260 AGCATGCAAAGCAGTTTAAGTGG - Intronic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1000186775 5:158866210-158866232 AGGCTTTGAAGGAGATCAAGAGG - Intronic
1001524961 5:172422364-172422386 AGGATCGGAAAGAGTTTAATTGG - Intronic
1002569373 5:180131340-180131362 AGGGTGGGAAGGAGTCAAAGGGG - Intronic
1002656016 5:180747825-180747847 AGGATGTGATGGAGGATGAGTGG - Intergenic
1003152911 6:3567640-3567662 GGAAGGTGAAGGAGTTTTAGGGG + Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1003630491 6:7782140-7782162 AAGATGTGAAGGAGTGCCAGAGG + Intronic
1003684397 6:8286939-8286961 AGGATGTAAAGGTGTTTAAATGG - Intergenic
1005695418 6:28347356-28347378 AAGATCTGAAGGAGATGAAGGGG - Intronic
1006121568 6:31809882-31809904 AGGATGTGAGGGAGTGTGATAGG + Exonic
1006621393 6:35367098-35367120 AGGAAATGGAGGAGTGTAAGAGG + Intronic
1006970879 6:38043585-38043607 AGGAAGAGAAGGAGGTGAAGGGG - Intronic
1007219641 6:40268473-40268495 TGGATGTGAGAGGGTTTAAGGGG - Intergenic
1009543371 6:64994618-64994640 AAAATGTGAAGGATTTGAAGTGG - Intronic
1011263272 6:85490333-85490355 AGGAAGGGAATGAGTTTAGGAGG - Intronic
1012122336 6:95384273-95384295 AGCATGGGAAGGAGGTCAAGGGG + Intergenic
1012521699 6:100128415-100128437 CGAATGTGATGGAGTTTGAGAGG + Intergenic
1013845878 6:114450906-114450928 CGGCTGTGAAGAAGTTTAAGAGG - Intergenic
1017381810 6:153839789-153839811 AAGATTTTAAGGAGTTTTAGAGG + Intergenic
1018357047 6:163028888-163028910 AGGATGTGAATGTGTTTGGGGGG - Intronic
1018845013 6:167549686-167549708 GGGATGTGAAGAAGGTTAGGAGG - Intergenic
1019360799 7:603356-603378 AGGATGTGTAGGAGTTTGTGAGG + Intronic
1026205257 7:68251756-68251778 AGGATGGAAAGGAGTTTTAAAGG - Intergenic
1026359201 7:69587268-69587290 AGGATTTTAAGCAGTTTCAGTGG + Intergenic
1026658453 7:72277663-72277685 AGGAAGTGAGGGAGGTGAAGAGG - Intronic
1026676381 7:72431955-72431977 ATGATGGCAAGGAGTTTAATAGG - Intronic
1027420530 7:78013650-78013672 AGGATGGGAAGGATTTCAAGAGG - Intergenic
1030613430 7:111713379-111713401 AGGATGTGAATGGGATTCAGGGG - Intergenic
1032479822 7:132237354-132237376 AGGATGTATTCGAGTTTAAGAGG + Intronic
1036158895 8:6368170-6368192 ATGATGTGAAGGATTTTCACTGG + Intergenic
1036593810 8:10194244-10194266 AGGGGGGGAAGGATTTTAAGAGG - Intronic
1037019278 8:13948473-13948495 TGGATGTGCAGGAGTTTACTGGG - Intergenic
1037535125 8:19817034-19817056 AGGTTGAGAAGAAGTTTGAGAGG - Intergenic
1037678929 8:21076890-21076912 AGGATTTGAAGTAGCTTAAAGGG + Intergenic
1038676825 8:29630368-29630390 AGAATATGAAGGAATTAAAGGGG - Intergenic
1039105448 8:33984580-33984602 GGGAGGTGAAGGAGTCTTAGAGG + Intergenic
1040991808 8:53359994-53360016 AGGATATGGAGGGGTTTGAGAGG - Intergenic
1041214839 8:55590295-55590317 AGGATGTTATGGACTTTGAGGGG + Intergenic
1041605732 8:59780624-59780646 GGGATGTGCAGTAGTTTTAGGGG - Intergenic
1043927046 8:86049197-86049219 AGAATGAGAAGGAGTAGAAGGGG + Intronic
1043934970 8:86132447-86132469 AGGAGGAGAAGTAGATTAAGAGG - Intronic
1045134604 8:99201558-99201580 ATTTTGTGAATGAGTTTAAGAGG + Intronic
1047062113 8:121239088-121239110 AGGATGTGAATGCGTGGAAGAGG + Intergenic
1047228994 8:122980024-122980046 AGGAAGAGAAGGAGTTCAAGAGG - Intergenic
1047469668 8:125157875-125157897 AGGATGTGAATAAGTATAATAGG + Intronic
1049996490 9:1040052-1040074 TGAATGTGATGGAGTTGAAGAGG + Intergenic
1050243360 9:3660629-3660651 AGGATGGGAATGAATTTTAGAGG + Intergenic
1052484921 9:29084627-29084649 GAGATGTAAAGGAGTTTATGTGG - Intergenic
1053325245 9:37139764-37139786 TGGATGTTAAGTAGCTTAAGAGG + Intronic
1058170760 9:101678374-101678396 CTGATGAGAAGGAGTTTAATAGG + Intronic
1058567965 9:106307123-106307145 AGGATGAGAAGGAGTTGAGTAGG - Intergenic
1058694407 9:107547299-107547321 AGGATGGGAAGGCTTTTAGGAGG + Intergenic
1059919982 9:119149307-119149329 AGGATTTGGAGAAGTTTAATGGG + Intergenic
1060016517 9:120091339-120091361 AGAATATGAAGGTGTTTAGGTGG - Intergenic
1060405189 9:123369492-123369514 AGGATGAGTAGGAGTTTGAAAGG + Intronic
1188379938 X:29478987-29479009 AGTCAATGAAGGAGTTTAAGGGG - Intronic
1188809211 X:34631802-34631824 AGGAAGTTAAGAATTTTAAGTGG - Intronic
1188896456 X:35674651-35674673 AGGATATGAAGGGGTTTATGGGG + Intergenic
1189002620 X:36962856-36962878 AGGAGAAGAAGGAGATTAAGTGG - Intergenic
1189245087 X:39557257-39557279 AAGATGTGTAGGAGTTTGACTGG - Intergenic
1190950243 X:55136417-55136439 AGGATGTGAAAGAGTCAATGAGG + Intronic
1191031636 X:55980158-55980180 AGGATGAAAAGGAGTTTCAGTGG + Intergenic
1191897612 X:66010070-66010092 AGGTTCTGAAGGACTCTAAGTGG + Intergenic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1196329302 X:114451217-114451239 AGGATTTGAAGCAGCTTAGGAGG - Intergenic
1197747145 X:129939312-129939334 AGGAGGTGAAGTAGATAAAGGGG - Intergenic
1199074624 X:143513706-143513728 AGGAGGAGAGGGAGTCTAAGAGG - Intronic
1199761669 X:150909284-150909306 AGGATGAGAAGGAGGTGAGGGGG + Intergenic