ID: 1112318151

View in Genome Browser
Species Human (GRCh38)
Location 13:98383216-98383238
Sequence TGCCTTGACAATAGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112318151_1112318155 4 Left 1112318151 13:98383216-98383238 CCAGGCCCTCTATTGTCAAGGCA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1112318155 13:98383243-98383265 ATAACGATGGCAGTATGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 57
1112318151_1112318154 -9 Left 1112318151 13:98383216-98383238 CCAGGCCCTCTATTGTCAAGGCA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1112318154 13:98383230-98383252 GTCAAGGCAACATATAACGATGG 0: 1
1: 0
2: 1
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112318151 Original CRISPR TGCCTTGACAATAGAGGGCC TGG (reversed) Intronic
900575926 1:3382413-3382435 TCCCTTGACATTTGAGGTCCTGG - Intronic
903045142 1:20558840-20558862 GACTTTGAAAATAGAGGGCCGGG + Intergenic
903650199 1:24917316-24917338 TGCCTTGGTAATAGAGGTGCAGG - Intronic
916485935 1:165258441-165258463 TGCATGGACAATAGAGTGGCAGG + Intronic
920293221 1:204938832-204938854 TGCCTAGAAGATTGAGGGCCCGG + Intronic
920540412 1:206773859-206773881 TGCCCTGACTATAGAGTGGCAGG - Intergenic
923612554 1:235507684-235507706 TCTCTTGAAAATACAGGGCCGGG + Intergenic
924197543 1:241623998-241624020 TGCCTGGAGCATAGAGTGCCTGG - Intronic
924197557 1:241624062-241624084 TGCCTGGAGCATAGAGTGCCTGG - Intronic
1063469799 10:6275195-6275217 CGCCATGACAACAGAGGGGCGGG - Intergenic
1067944618 10:50682186-50682208 TGCCTTGACACTGGAGGTCATGG + Intergenic
1068524311 10:58109850-58109872 TGGCTAGACAATAGATTGCCTGG - Intergenic
1068588191 10:58824446-58824468 TGCTTTGACCATATAGGGGCAGG + Intronic
1069632959 10:69908641-69908663 TGTCCTGACGCTAGAGGGCCTGG + Intronic
1070729854 10:78819092-78819114 TGCCTTTACAATAGAAGCCCAGG - Intergenic
1070866121 10:79709057-79709079 TGCCTTGACACTGGAGGTCATGG + Intronic
1070879914 10:79847188-79847210 TGCCTTGACACTGGAGGTCATGG + Intronic
1071633024 10:87231278-87231300 TGCCTTGACACTGGAGGTCATGG + Intronic
1071646473 10:87363496-87363518 TGCCTTGACACTGGAGGTCATGG + Intronic
1073217646 10:101845218-101845240 GGCCTTTACAATGGAGGGCAAGG + Intergenic
1073516352 10:104078918-104078940 TGACTTGAGACAAGAGGGCCTGG - Intronic
1078018168 11:7633050-7633072 TGCCCTAACAACAGAGGGGCAGG - Intronic
1083804123 11:65063726-65063748 TGCCTTGATGACAGAGGCCCAGG + Intergenic
1084541052 11:69787512-69787534 TGCCTTGGGAGTGGAGGGCCAGG - Intergenic
1087119672 11:94560343-94560365 GCCATTGACATTAGAGGGCCAGG + Intronic
1089294214 11:117458300-117458322 TGCCTTGACAGTCCAGGGCCAGG + Intronic
1093533401 12:20194441-20194463 GGCCTTGACAATGGAGGGAGAGG - Intergenic
1094469260 12:30788324-30788346 TCCCTTAACAATAAAGGGACCGG - Intergenic
1103191521 12:119005981-119006003 TTCCTGGACAATAGATGACCAGG - Intronic
1103353571 12:120303016-120303038 AGCTGTAACAATAGAGGGCCGGG - Intronic
1108140791 13:47419070-47419092 TGCCTAGAAAGTTGAGGGCCAGG - Intergenic
1108180727 13:47837371-47837393 TGGCTTAAAAATAAAGGGCCAGG - Intergenic
1112318151 13:98383216-98383238 TGCCTTGACAATAGAGGGCCTGG - Intronic
1113182438 13:107645579-107645601 TGTTTTGACAACAGAGAGCCTGG + Intronic
1117322864 14:54640708-54640730 TGCTGTGACAATTGAGGGCTGGG - Intronic
1119157932 14:72428713-72428735 TGATTTGAGAATAGAAGGCCCGG + Intronic
1120548224 14:85836744-85836766 AGCCAGGACAATACAGGGCCAGG + Intergenic
1126499671 15:49331396-49331418 TGCCTTGATAATTGAGGGCAGGG + Intronic
1129071740 15:72957141-72957163 CGCCTTGACACTATGGGGCCTGG + Intergenic
1131644115 15:94323564-94323586 AGCCTTGACAATAGGAGGTCTGG + Intronic
1132905461 16:2280468-2280490 TGCCTGGACAGCAGAGGCCCTGG - Intronic
1134297323 16:12958523-12958545 TGTCTTCATAATAGATGGCCTGG + Intronic
1141196472 16:81865144-81865166 TGAATTGAGACTAGAGGGCCAGG + Intronic
1150283215 17:63941217-63941239 TGCCCTGACCAAAGAGGTCCTGG - Exonic
1151204262 17:72494061-72494083 TGCCTTGAGAAATGAGGGCTGGG - Intergenic
1164934746 19:32201957-32201979 TCCCGAGACAATGGAGGGCCTGG + Intergenic
932917737 2:75875882-75875904 TTGCTTGACCATTGAGGGCCAGG + Intergenic
933857239 2:86427782-86427804 CGTCTTGATATTAGAGGGCCAGG + Intergenic
941355767 2:164489230-164489252 TGCCTGGACAGTACAGGGCATGG - Intergenic
946121515 2:217519399-217519421 TTCCTTGACTATAGTGGACCAGG - Intronic
946883122 2:224195875-224195897 TCCATTGCCAATAGAGGACCTGG - Intergenic
1169013520 20:2272128-2272150 CGGCTTGACTATAGAGGGACAGG - Intergenic
1170041852 20:12047147-12047169 TGCCTTGAGAAAAATGGGCCAGG + Intergenic
1172437781 20:34942257-34942279 TGCCTGTACAATGGAGGGACAGG + Intronic
1176431510 21:6579088-6579110 TCCCTGGACTATACAGGGCCAGG - Intergenic
1179605533 21:42513519-42513541 TGCCTTGAGGACAGAGCGCCAGG + Intronic
1179706904 21:43186550-43186572 TCCCTGGACTATACAGGGCCAGG - Intergenic
1182351544 22:29702759-29702781 TGCCTTGGCTATAGAAGGTCAGG + Intergenic
1182577419 22:31282471-31282493 TGCCTTGACAACCGTGGGCCAGG - Exonic
1182835558 22:33338720-33338742 TGCCTAGAGTATAGAGGGCTGGG + Intronic
1183112498 22:35660758-35660780 TGCCTTTATAAAAGAGGCCCAGG - Exonic
957338844 3:78866795-78866817 TCTCTTGAGAATAGAGGGGCAGG + Intronic
966249526 3:177847678-177847700 AGACTTGACAATAGGGGGCTAGG - Intergenic
966825221 3:183959279-183959301 TGTCTTGACAATATAGCACCAGG - Intronic
967595042 3:191317948-191317970 AGCCTTGACATAAGAAGGCCAGG - Intronic
968228707 3:196991856-196991878 TGCCTTGAGGCAAGAGGGCCTGG - Intronic
969528757 4:7717988-7718010 TGGATTGACAAGAGAGGGTCAGG - Intronic
975265782 4:72365039-72365061 TGCCTACACAGTACAGGGCCTGG + Intronic
976745016 4:88393876-88393898 TGCCCTCACAAAAGAGGCCCAGG - Intronic
981717643 4:147767232-147767254 TGCTTTGAGAAGAGAGGCCCTGG - Intronic
983503926 4:168531833-168531855 TGCTTTGGCAATTGAGGGGCTGG + Intronic
985135550 4:186782497-186782519 TGCCCTTAAAATAGAGAGCCTGG + Intergenic
993884033 5:93395797-93395819 TCCCTGAACAATAGAGGGCATGG + Intergenic
995846402 5:116498685-116498707 TGCCTTGAAATTAAAGGGCAGGG - Intronic
996613283 5:125410097-125410119 TGCAGTGACAAAGGAGGGCCAGG + Intergenic
997368486 5:133340934-133340956 GCTTTTGACAATAGAGGGCCAGG - Intronic
997422002 5:133776838-133776860 ATCATTGACAATAGATGGCCTGG - Intergenic
997877295 5:137560715-137560737 TGCCCTGATAAAAGAGGGCCGGG - Intronic
999886684 5:155931991-155932013 TGCCCTTACAATAGAGGCCAGGG - Intronic
1001130880 5:169062454-169062476 TGCCTTGGCCCTAGAAGGCCTGG + Intronic
1015770105 6:136759956-136759978 TTCTTTGAAAATAGAGGGCTGGG - Intronic
1022185198 7:27960630-27960652 TGCCCTGACAATTGAGGGGTTGG + Intronic
1022597129 7:31723435-31723457 TGAGTTGACACTAGAGTGCCAGG - Intergenic
1023828935 7:44028250-44028272 TGCCTTCATCATAGAGGCCCGGG - Intergenic
1025602136 7:63011057-63011079 TGTCTTAAAAAAAGAGGGCCAGG - Intergenic
1028937594 7:96483756-96483778 TGCCTTGAAGACAGAGAGCCAGG + Intronic
1029555987 7:101269550-101269572 TGTCTTTAAAAAAGAGGGCCAGG - Intergenic
1029739234 7:102482507-102482529 TGCCTTCATCATAGAGGCCCGGG - Intronic
1029757235 7:102581686-102581708 TGCCTTCATCATAGAGGCCCGGG - Exonic
1029775175 7:102680747-102680769 TGCCTTCATCATAGAGGCCCGGG - Intergenic
1033531669 7:142270471-142270493 TGCAGTGACAGTAGAGGGCAAGG - Intergenic
1034217030 7:149415636-149415658 TGCGATGAAAATGGAGGGCCCGG + Intergenic
1034334469 7:150311767-150311789 AGCCTTGATAATAGAGGTACAGG - Intronic
1035119180 7:156550385-156550407 TTCCTTGAGAATGCAGGGCCTGG - Intergenic
1037530864 8:19772085-19772107 TGCCTTTACAAAAGAGGTCAAGG + Intergenic
1048766506 8:137850145-137850167 TGGCTTGAAAATACAGGGTCTGG + Intergenic
1049182372 8:141229516-141229538 GGCCTTGACAAGGGAGTGCCTGG - Intronic
1049615476 8:143573999-143574021 TGCTTCGACAAGAGAGGCCCAGG + Intergenic
1050217130 9:3339279-3339301 TGCCCTGACAACAGAGGTCAGGG + Intronic
1050520642 9:6495625-6495647 TGCCCTGATAAAAGATGGCCAGG - Intronic
1053268856 9:36736205-36736227 TGCCTTGGCAAAAGAGAGCTGGG + Intergenic
1056100204 9:83293669-83293691 TGCCTTGGCATTAGATGGCCAGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057565988 9:96166735-96166757 TGCCTTTATAAAAGAGGCCCTGG + Intergenic
1057816867 9:98302447-98302469 GGCCGTGAAAAGAGAGGGCCCGG - Intronic
1060649432 9:125312736-125312758 TGCCTTGACTATAGACTTCCTGG - Intronic
1062205716 9:135335794-135335816 TGCCTTGGTCATAGAGGGCCGGG - Intergenic
1185522678 X:753466-753488 TGCCTTGACAATTAAGGCACGGG + Intergenic
1186077860 X:5900085-5900107 TGCTGTCACAAAAGAGGGCCTGG + Intronic
1188848480 X:35103272-35103294 TCCATTGAAAATAGAGGGCAAGG - Intergenic
1194219548 X:91174780-91174802 TGCCTTGACAATAAGGGCCTTGG - Intergenic
1194906167 X:99578247-99578269 TTCCATGACAATAGAAGGCAGGG - Intergenic
1200556060 Y:4638544-4638566 TGCCTTGACAATAAGGGCCTTGG - Intergenic
1201943201 Y:19482099-19482121 TGCCTTGACAATTGGGGGCTTGG + Intergenic
1201943248 Y:19482524-19482546 TGGCTTGACAATTGGGGGACTGG + Intergenic