ID: 1112319815

View in Genome Browser
Species Human (GRCh38)
Location 13:98395861-98395883
Sequence GCTGCTGCTGGGAGACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112319815_1112319824 13 Left 1112319815 13:98395861-98395883 CCCCATTGTCTCCCAGCAGCAGC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 1112319824 13:98395897-98395919 ATATGAGTTGGGACAGAACTGGG 0: 1
1: 0
2: 1
3: 14
4: 177
1112319815_1112319823 12 Left 1112319815 13:98395861-98395883 CCCCATTGTCTCCCAGCAGCAGC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 1112319823 13:98395896-98395918 AATATGAGTTGGGACAGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 153
1112319815_1112319821 2 Left 1112319815 13:98395861-98395883 CCCCATTGTCTCCCAGCAGCAGC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 1112319821 13:98395886-98395908 TTCAAGTCCAAATATGAGTTGGG 0: 1
1: 0
2: 1
3: 18
4: 197
1112319815_1112319825 21 Left 1112319815 13:98395861-98395883 CCCCATTGTCTCCCAGCAGCAGC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 1112319825 13:98395905-98395927 TGGGACAGAACTGGGTCTCAAGG 0: 1
1: 0
2: 1
3: 49
4: 399
1112319815_1112319820 1 Left 1112319815 13:98395861-98395883 CCCCATTGTCTCCCAGCAGCAGC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 1112319820 13:98395885-98395907 GTTCAAGTCCAAATATGAGTTGG 0: 1
1: 0
2: 3
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112319815 Original CRISPR GCTGCTGCTGGGAGACAATG GGG (reversed) Intronic
902628874 1:17692945-17692967 GAGGCTGCTGGGTGACAAGGCGG - Intronic
902785918 1:18732660-18732682 GCTTTTGCTGAGAGATAATGGGG + Intronic
902788921 1:18751857-18751879 GCTGCTGCCTGGAGCCAATTAGG - Intergenic
903473836 1:23605975-23605997 GCTGGTGTTGGGAGAAAAGGCGG - Intronic
903555956 1:24193521-24193543 GCTGCTGCTTGGACTCATTGGGG + Intergenic
903664983 1:25000836-25000858 GATGCTGCAGGGAGACTACGTGG + Intergenic
904342592 1:29846492-29846514 GCTGCTGCTGAGATGCACTGAGG + Intergenic
904452247 1:30621258-30621280 GCTGCTGCTGAGATGCACTGAGG - Intergenic
904828248 1:33289450-33289472 GCTGAGGCTGGGAGTCAAGGGGG + Intronic
905105528 1:35561344-35561366 GCTGGAGCTGGGAGGCAAGGGGG + Intronic
906787084 1:48625486-48625508 GCTGCGGCTGGGGGACAGTGAGG + Intronic
907287432 1:53390800-53390822 GCTGCTGCTGGAATACCCTGGGG + Intergenic
909825522 1:80121650-80121672 GCAGCTGCTGGCAGACAAAATGG + Intergenic
911656646 1:100451315-100451337 GCTACAGCAGGGAGACAGTGGGG - Intronic
912386638 1:109274142-109274164 GCTGCTGCGGGCAGGCGATGGGG - Exonic
912953164 1:114134572-114134594 GCAGCTGCTGTGAGACCAGGAGG + Intronic
914705042 1:150163297-150163319 GCTCCTGTTGGGAGACAGGGAGG - Intronic
914938767 1:152003746-152003768 GGTGAAGCTGGGAGAAAATGAGG + Intergenic
916022783 1:160808469-160808491 GGAGCTGCTGGGAGACTGTGGGG - Intronic
916460088 1:165014889-165014911 GCACCTGCTGGGAGGCAGTGGGG + Intergenic
917491262 1:175500531-175500553 GCTGGTGCTGGGTGACCTTGGGG + Intronic
918015931 1:180632387-180632409 GCTGCCGCGGGGAGCCACTGCGG + Intronic
920431492 1:205921829-205921851 GCTCCTGCAGGGAGACAGTCTGG + Exonic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
922798283 1:228352210-228352232 GCTGCTGCTGTGAGCCTGTGGGG + Intronic
923389463 1:233499523-233499545 ATTGCTACTGGCAGACAATGGGG - Intergenic
923391050 1:233515041-233515063 GCGGCTGCAGGGAGAGCATGGGG + Intergenic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
1063380069 10:5578837-5578859 GCTGCTGCTGGGTGAGAACTTGG - Intergenic
1065205351 10:23352227-23352249 GCTGCTGCTACAAGAGAATGAGG - Intergenic
1066012707 10:31209300-31209322 GCTGATGCTGGAACAAAATGGGG - Intergenic
1067349551 10:45463497-45463519 CCTGCTGCTGGAAGAGAAGGCGG - Exonic
1067532951 10:47087787-47087809 GCAGGTGCAGGGAGAGAATGAGG - Intergenic
1069813453 10:71179087-71179109 GCTGCAGGTGGGAAGCAATGAGG - Intergenic
1071872331 10:89808972-89808994 GCTGCTTCTGGGAGACAAAGTGG + Intergenic
1071935650 10:90527120-90527142 GCTGCTGCTGGGAGCTGAGGGGG + Intergenic
1072978315 10:100078466-100078488 GCAGCTGCAGGGAGACCAAGTGG - Intronic
1074382033 10:112989065-112989087 GCAGCTGCTGGGAGTCTAGGTGG + Intronic
1076465262 10:130676495-130676517 GCTGCTGCTCTGTGAAAATGTGG + Intergenic
1076679052 10:132162123-132162145 TCTGCTTCTGGGAGACACTGGGG + Intronic
1077231339 11:1459382-1459404 GCTGCTCCTGGTAGAGGATGGGG - Intronic
1077350871 11:2092671-2092693 GCTGCTGGAAGGAGACAGTGGGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077610340 11:3639984-3640006 GCAGCTGCTGCGAGGCAGTGGGG - Exonic
1077888221 11:6401706-6401728 GATGGTACTGGGAGACACTGAGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078421927 11:11219552-11219574 GCTGCTGTTGTGAGAAACTGGGG - Intergenic
1078484579 11:11709797-11709819 GCCACTGCGTGGAGACAATGGGG - Intergenic
1078854705 11:15197602-15197624 GCTGCTTCTGGGAGAAAATGTGG + Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1081617251 11:44598168-44598190 GATTCTGGTGGGAGACACTGGGG + Intronic
1081783925 11:45733128-45733150 GCTGCAGCTCCAAGACAATGGGG - Intergenic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083763545 11:64831655-64831677 GCTGCTGCTGGCAGAGAGCGAGG - Exonic
1083773860 11:64883646-64883668 GCTGAGGCTGGGGGACAATGGGG - Intronic
1083869606 11:65478829-65478851 GCTGCTGCGGGGAGGGAAGGAGG - Intergenic
1084198312 11:67539008-67539030 GCTGGTGCTCTGGGACAATGTGG + Intergenic
1084619964 11:70263028-70263050 GCAGCTGCTGTGAGACCATAAGG - Intergenic
1085514224 11:77103001-77103023 GCTGCTGCTGGGTGAAGTTGAGG - Exonic
1085574517 11:77590085-77590107 GCTGCTGCCGGGCGACTACGCGG - Exonic
1085851091 11:80121191-80121213 CCTGCCTTTGGGAGACAATGAGG - Intergenic
1086863656 11:91953849-91953871 CCTACTGCTGAGAGACAATTTGG - Intergenic
1087369416 11:97263407-97263429 GCTGCTTCAGTGATACAATGTGG + Intergenic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1089844788 11:121450308-121450330 GCTGGTCCTGAGAGACCATGGGG + Intergenic
1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG + Intergenic
1090185844 11:124738715-124738737 GCTCCTGCTGGGAGCAAAGGTGG - Intergenic
1091215505 11:133898972-133898994 GCTGCTGGTTGGTGACAGTGGGG + Intergenic
1091786140 12:3244426-3244448 GCTGCGGCTGGCAGAGAATAAGG - Intronic
1094439027 12:30454490-30454512 GCTGGTGCTGGGAGAGATTCTGG - Intergenic
1095495667 12:42781072-42781094 GCTGCTGCTGGCAGGCCCTGCGG - Intergenic
1096588063 12:52636645-52636667 GCTGCTGCTGGGAAAAGATGTGG - Intergenic
1096981339 12:55729393-55729415 GCTGAGGCCGGGTGACAATGTGG + Exonic
1098071447 12:66679952-66679974 GCTGCTGCTGGCAGATGAGGAGG - Intronic
1102248177 12:111368379-111368401 CCCGCTGCTGGGGGACACTGAGG - Intronic
1103904569 12:124320769-124320791 GCTGTAGCTGGGAGACAGAGTGG + Intergenic
1103908864 12:124340881-124340903 GCTGGTGCTGGGAGCCGAGGAGG - Intronic
1105364276 13:19750365-19750387 GAGGCTGCAGGGAGACAATATGG + Intronic
1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG + Exonic
1106449991 13:29872335-29872357 GCTGCTGCAGGGGGGCAATTTGG - Intergenic
1107088165 13:36447968-36447990 GGTGCTGAGGGGAGAGAATGGGG + Intergenic
1107808365 13:44175607-44175629 GCTGCTGCTGGGGGATGGTGGGG + Intergenic
1109330867 13:60927999-60928021 GCCTCTGGTGGGAGGCAATGTGG + Intergenic
1110441213 13:75527845-75527867 GCTGAGGCTGGGGGTCAATGGGG + Exonic
1111020677 13:82445043-82445065 GCTGCTGATGTGAAACAAGGTGG - Intergenic
1111685413 13:91495508-91495530 ACTGCTGCTGGGACAGAGTGAGG - Intronic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1113924571 13:113934231-113934253 GCACCTGCTGACAGACAATGGGG + Intergenic
1115114544 14:29863921-29863943 GCTACTTCTGGGAAACAATGTGG + Intronic
1116025145 14:39505785-39505807 GCTGATCTTGGGAGACAATGTGG + Intergenic
1116937553 14:50757837-50757859 GCAGCTGTTGGAAGAAAATGGGG - Exonic
1121451319 14:94010066-94010088 GGTGCTGCTGGGAGAGGGTGGGG + Intergenic
1121627946 14:95400371-95400393 GCTGCTGATGAAAGACAATGGGG + Intergenic
1122069092 14:99194248-99194270 TCTGCTGCTGGGGGACAGTCCGG - Intronic
1122317469 14:100834678-100834700 GCTGGTGCTGGGACACCCTGAGG - Intergenic
1124631282 15:31338991-31339013 GCTCATCCTGGGAGACACTGTGG + Intronic
1125990324 15:44100397-44100419 TTTGCTGCTAGGTGACAATGTGG - Intronic
1127760593 15:62135830-62135852 GCTGCTGCTGGGAAACGAAGAGG - Intergenic
1128943692 15:71807870-71807892 GCTGCTGCTGAAACCCAATGAGG + Intronic
1129831156 15:78671749-78671771 GCTGCTCCAGGGAGGAAATGAGG + Intronic
1130569674 15:85030354-85030376 ACTGTGGCTGGGAGACAAAGAGG - Intronic
1130872887 15:87985243-87985265 GCTACTGCTGGGAGAGAAGGTGG + Intronic
1131056318 15:89377447-89377469 GCTGGGGCTGGGAGCCAAGGGGG + Intergenic
1131224174 15:90610384-90610406 GCTGTTGCTGTGAGCCCATGAGG + Intronic
1131308572 15:91267410-91267432 GCTGCCTCTAGGAGACAGTGGGG + Intronic
1132658098 16:1049629-1049651 GGGGCCGCTGGGAGACACTGTGG + Intergenic
1132854867 16:2040235-2040257 ACTGCTGCTGGGAGGCCAAGCGG + Exonic
1133224999 16:4336903-4336925 GCTGCTCGTGGGACACAAAGTGG - Exonic
1133265697 16:4582371-4582393 GCTGTTGCTGGGATGCACTGGGG + Intronic
1134359492 16:13518004-13518026 GCAGCTGCTGGCAGTCAAGGAGG + Intergenic
1134757402 16:16680100-16680122 GCTGTTTCTGGGATACAAGGGGG + Intergenic
1134988666 16:18679066-18679088 GCTGTTTCTGGGATACAAGGGGG - Intergenic
1136251666 16:29009468-29009490 GCTGCTGCTGAGAGATAACGCGG + Intergenic
1138248489 16:55484613-55484635 GATGATGCTGGTAGACACTGAGG + Intronic
1138369748 16:56517336-56517358 GCTGGGGCTGGAAGGCAATGAGG - Intronic
1139472374 16:67185054-67185076 GCAGCTGCGGGGAGGCAATCAGG + Exonic
1140035359 16:71367599-71367621 GCAGCTGATGGCAGACAGTGAGG - Intronic
1140646768 16:77039263-77039285 GCTGCTGCTGGGAGTATAGGAGG + Intergenic
1142274935 16:89113430-89113452 GCTACTGCTGGGATACCCTGGGG + Intronic
1142280020 16:89143143-89143165 GCTGATGCTGGGAGAAACTGGGG - Intronic
1143481410 17:7229544-7229566 GCTGGTGCTGGGAGAAGGTGGGG - Intronic
1143514989 17:7415035-7415057 GCGGCTGCTGGCAGCCAAGGTGG + Exonic
1143781812 17:9233115-9233137 GAAGCTGCTGGGAGCCACTGGGG + Intronic
1145904408 17:28508292-28508314 GCTGTTGGTTGGAGGCAATGTGG - Intronic
1145995428 17:29102299-29102321 GCTGCTGCTGGCTGCCACTGGGG - Intronic
1147132014 17:38415221-38415243 GCTGCTCATGGGAGAGACTGGGG + Intergenic
1147262761 17:39218167-39218189 GCTGGAGCTGGGAGAAAAAGAGG + Exonic
1147744764 17:42688359-42688381 GCTGCTACTGGGACACAGTGGGG + Intronic
1148080725 17:44966710-44966732 GCTGGAGCTGGGAGACCAAGAGG + Intronic
1148809337 17:50280212-50280234 CCACCTGCTGGGAGACAATGGGG + Exonic
1149252308 17:54784358-54784380 TCTGCTGCTAGGAGACCTTGGGG + Intergenic
1149791253 17:59479380-59479402 GCTTCTTCTGGGAGTCAATTAGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150308983 17:64112006-64112028 ACTGGTGCTAGGAGACAATCAGG + Intronic
1150788702 17:68183078-68183100 GCTGCTGGTGTGAGCCAAGGGGG - Intergenic
1153320965 18:3774001-3774023 GCAGCTGCTGGGAGATGTTGGGG - Intronic
1153443904 18:5151156-5151178 GCTGCTGCTGGTAAACAGGGAGG + Intronic
1157312951 18:46566120-46566142 GGTCCTGCAGGGAGAAAATGGGG - Intronic
1157929812 18:51809286-51809308 GCTGCTGCTGAGTCACAATAAGG - Intergenic
1158111743 18:53947623-53947645 GCTGATTCTGGGAAACAAAGAGG - Intergenic
1158266897 18:55669238-55669260 GAGGCTGATGGGAGAGAATGGGG + Intergenic
1160234893 18:77078047-77078069 GCTGGGGCTGGGAGATAAGGAGG - Intronic
1160245427 18:77155249-77155271 GCGACTGCCGGGAGACACTGAGG + Intergenic
1161470749 19:4455781-4455803 GCTGCCGCAGGGAGAGAAGGAGG + Intronic
1161862879 19:6811503-6811525 GCTGCAGTTGGGGGAGAATGAGG + Intronic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162872781 19:13598852-13598874 TCTTCTGGTGGGAGACACTGGGG - Intronic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1165215092 19:34265360-34265382 GCTGCTCCTGGGTGTCAAGGTGG + Intronic
1165758031 19:38305300-38305322 GCTGCTGCTGGGGGCCACTGTGG - Exonic
1165929511 19:39347470-39347492 ACTGCGGCTGGGGGACAGTGGGG - Intronic
1166420156 19:42630414-42630436 GCTGCTGCAGGGTGCCAGTGGGG + Intronic
1166975567 19:46603231-46603253 GGTTCTGCTGGGGGAAAATGGGG - Intronic
1167062063 19:47155368-47155390 GCTGTTGCTGTGAGGGAATGTGG + Intronic
1168622229 19:57888712-57888734 GCTGCTTTTGGGTGACGATGAGG + Intronic
925561557 2:5201719-5201741 GCTGATGCTAGGGGACAACGAGG - Intergenic
926009880 2:9399564-9399586 CCTGCTTCTGGGAACCAATGTGG - Intronic
926087387 2:10028869-10028891 GCTGGTCCTGGGAGACGCTGAGG - Intergenic
926234545 2:11029345-11029367 CCAGATGCTGGGAGATAATGAGG - Intergenic
926403050 2:12519669-12519691 GAAGCTGCTGGAAGATAATGAGG + Intergenic
926684954 2:15691227-15691249 GCTGCTGCAGGGAGACCCGGCGG + Intronic
926902260 2:17765534-17765556 GATACTGCTGGGAGACATTTTGG + Intronic
927164455 2:20303228-20303250 GCTTCTGCTCGGAAACAATATGG + Intronic
927192964 2:20529527-20529549 AGTGCTGCTGGGAGCCACTGAGG + Intergenic
927506991 2:23621164-23621186 GCTGCTGCTGGGTGAGAACTGGG - Intronic
928245683 2:29624892-29624914 CCTGGTGCTGGGTGAGAATGGGG + Intronic
928290958 2:30037096-30037118 GCTCCTGCTCTCAGACAATGTGG + Intergenic
928347606 2:30515856-30515878 GCTTCTGCTGGAAGAAAATTGGG - Intronic
929235717 2:39603609-39603631 GCGGGAGCTGGCAGACAATGTGG - Intergenic
929918425 2:46155119-46155141 GTTGCTGCTGGGGGATCATGAGG - Intronic
930090521 2:47528311-47528333 GCTCATCCTGGGAGACAAGGTGG + Intronic
930619471 2:53628979-53629001 GCTGCTCCTGGGAGCCCATTGGG + Intronic
931105094 2:59046606-59046628 CATGCTGCTAGGAGACAAAGAGG + Intergenic
932058228 2:68467815-68467837 GCCGCTGCTGGGAGTAAGTGTGG + Exonic
932715019 2:74094528-74094550 GCTGCTGCAGTTAGAGAATGAGG + Intronic
934492963 2:94774718-94774740 GCTTCTGCTTGGAAACAGTGGGG - Intergenic
934737602 2:96697863-96697885 GCTGTCTCTGGGAGACAGTGCGG - Intergenic
935196663 2:100820327-100820349 GCCGCCGCTGGGAGACGAGGCGG - Exonic
935522258 2:104122031-104122053 GCTGCTGCTGAGAACCAGTGAGG - Intergenic
936111712 2:109670638-109670660 GCTGCTGCTCGAAGCCAGTGGGG + Intergenic
937226761 2:120374819-120374841 GTTGCTGCGGGGACTCAATGGGG - Intergenic
938239791 2:129734599-129734621 GCTGCAGCTGTGAGAGAAGGAGG + Intergenic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
938930956 2:136086609-136086631 GCTGATGCTGGAATAAAATGGGG + Intergenic
939176325 2:138752204-138752226 TCTGATGCTGAGAGAAAATGAGG - Intronic
940444056 2:153755047-153755069 ACTGCTGCTGCCAGAGAATGAGG + Intergenic
942116689 2:172735663-172735685 CCCGCTGCTGGGGGACACTGGGG - Intronic
942485157 2:176431236-176431258 GATCCTTCTGGGAAACAATGTGG + Intergenic
943470944 2:188292676-188292698 GTTGGCGCTGGGAGAGAATGTGG + Intronic
947713677 2:232329614-232329636 ACTGGTGCAGGGAGACCATGGGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948968065 2:241400193-241400215 GCTGCCCCTGTGAGTCAATGGGG - Intronic
1168813354 20:720568-720590 GCTGGTGCTGGGAGAGAGTTAGG + Intergenic
1168940091 20:1702479-1702501 GCTGCTCCTGGGAGTGAGTGGGG - Intergenic
1168979722 20:1994128-1994150 CAGGCTGCTGGGAGCCAATGGGG + Exonic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1173487050 20:43448651-43448673 GCACCTGGTGGGAGACAATTGGG - Intergenic
1174053523 20:47783678-47783700 GCTGCAGCTGAGGGTCAATGTGG - Intronic
1175286466 20:57840105-57840127 GCTTTTGCTGGATGACAATGTGG + Intergenic
1175381302 20:58566242-58566264 GGTGCACCTGGGAGACAGTGAGG - Intergenic
1175834963 20:61987638-61987660 GCGGCTGCTGGAAGACAGTCTGG + Intronic
1175937620 20:62521576-62521598 GCGGCTGCTGGAAGACAGTCTGG - Intergenic
1177120246 21:17128999-17129021 GCAGCAGCTCAGAGACAATGAGG + Intergenic
1178833843 21:36079333-36079355 ACTGCTGCTCTGAGACAAGGTGG - Intronic
1178865134 21:36320563-36320585 ACAGCTGCTGGGAGACTAGGAGG - Intronic
1179396220 21:41042848-41042870 GCTGCTGCTGGTAGAGAAGAAGG - Intergenic
1179482279 21:41685824-41685846 GCTGCTGCTGGGAGAGGGAGGGG + Intergenic
1179486716 21:41715280-41715302 CCTGCTGATGGGAAACAAAGCGG + Intergenic
1179502837 21:41820845-41820867 GCTGGTGCCAGGAGACTATGCGG + Intronic
1179659173 21:42863617-42863639 GCTGCTCCTGGAAGCTAATGGGG - Intronic
1179959500 21:44760076-44760098 TCTGCTGCAGGGAGAGAGTGAGG - Intergenic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1180000307 21:44992627-44992649 GTGGCTACTGGGAGACCATGAGG - Intergenic
1180255773 21:46626342-46626364 TCTTCTGCTGGGAGAAACTGGGG + Intergenic
1180951766 22:19723654-19723676 GCTGCAGCTGGGAGAGACTTGGG + Intronic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1181314686 22:21963704-21963726 GCTGTTGCAGGGAGGCAAGGGGG - Intronic
1181511770 22:23392595-23392617 GCTGCGGCTGGGGGACACTGGGG - Intergenic
1181796648 22:25316480-25316502 GCTGAGGCAGGGAGATAATGAGG + Intergenic
1182354195 22:29714941-29714963 GGTCCTGCTGGGAGAGAAGGAGG + Intergenic
1182420938 22:30248259-30248281 GGCCCTGCTGGGAGAGAATGGGG - Intergenic
1182445198 22:30385986-30386008 CCAGCTGCAGGGAGACAAGGAGG + Exonic
1183034483 22:35130919-35130941 GCTGTTTGTTGGAGACAATGGGG + Intergenic
1183180009 22:36253613-36253635 GCTGCTGCTGAGGCCCAATGGGG + Intronic
1183270313 22:36858203-36858225 CCTGCTGCAGGGGGAGAATGAGG - Intergenic
1183406144 22:37631577-37631599 CCCACTGCTGGGAGACACTGTGG - Intronic
1184199804 22:42960439-42960461 CGTGCTGCTGAGAGACCATGGGG - Intronic
951604694 3:24420177-24420199 GCTGGTCCTGGGAGACACTGAGG - Intronic
954098700 3:48352850-48352872 GCTGCTGCTAAGAGACCAAGAGG + Intergenic
954524717 3:51259960-51259982 GCTGCTGCTTAGTGACAATTTGG + Intronic
954709468 3:52498201-52498223 GCTGCTGCTGGGGGAAGTTGAGG - Intronic
954840982 3:53511332-53511354 GCCGCTGCTGGGAAACCTTGAGG - Intronic
955353521 3:58211319-58211341 CCTTCTGCTGGGGGACAATGAGG + Intronic
955356741 3:58237992-58238014 GCCGCTGCAGGGAGACACTGGGG - Intronic
955532804 3:59891646-59891668 CCTGCTGCTGGGAGACACAAAGG - Intronic
955694960 3:61626671-61626693 CCTGCTGCTGGGTGCCAAAGTGG + Intronic
956438000 3:69253205-69253227 GCAGATGATGGGAGGCAATGAGG + Intronic
957231960 3:77530995-77531017 GTTGCTGCTGGGAAAAAATGTGG - Intronic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
960126617 3:114005692-114005714 GCTGTTGCTGGAAGACATGGCGG + Exonic
960204225 3:114875640-114875662 GTTGCTTCTGGGTGACAATGAGG + Intronic
961319207 3:126061358-126061380 GAGGCTGCTTGGAGACAGTGTGG - Intronic
961386724 3:126526949-126526971 GCAGGTACTGGGAGACAGTGGGG + Intronic
961470388 3:127107632-127107654 GCTGTTTGTGGGAGAAAATGGGG + Intergenic
962485703 3:135840219-135840241 GATCCTGCTGGGAGATAATATGG - Intergenic
962688255 3:137868214-137868236 GCTGCTGCTGGGGGTCAGGGAGG - Intergenic
968605163 4:1531977-1531999 GCTGCTGATGGGGGACAGAGCGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969298002 4:6280893-6280915 GCTGCTGCTCGGAGACGGAGTGG - Intronic
969499261 4:7543213-7543235 GCTGCAGTTGGGAGACAAACGGG + Intronic
970198249 4:13574683-13574705 GCTGCTGCTAGGAGAGGGTGAGG - Intronic
970586029 4:17515225-17515247 GCTGCTGCTCGGAGACCTTGGGG + Exonic
972338520 4:38129925-38129947 GTGGCTGTTGGGAGACAATTTGG + Intronic
972780096 4:42279831-42279853 GCCGCTGCAAGGAGACATTGTGG + Intergenic
973571674 4:52246590-52246612 GCTGGAGCTGGGAGTCAAAGAGG - Intergenic
973955971 4:56063537-56063559 GCTGCCCCTGGTAAACAATGAGG - Intergenic
975749226 4:77505928-77505950 GCAGCAGCTGAGAGACCATGAGG - Intergenic
976818149 4:89174399-89174421 CCTGCTTGTGGGAGACACTGAGG + Intergenic
976896651 4:90120206-90120228 GCTGTTGTTGGCTGACAATGGGG + Intergenic
978935209 4:114366259-114366281 GCTGCTGCTGATAGGTAATGGGG - Intergenic
980247575 4:130267275-130267297 TCTGCTGCAGGGAGACCTTGTGG + Intergenic
980730119 4:136812783-136812805 GCTGCTGCAGGGAGAGTAAGGGG - Intergenic
983779181 4:171646102-171646124 GCTACAGCTGGGATACCATGTGG + Intergenic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
985972091 5:3386378-3386400 GCTGCTGCTGGGGGAGAAAAGGG + Intergenic
990936231 5:61152873-61152895 AGTGCTGCTGGGAGCCACTGAGG - Exonic
991778274 5:70106856-70106878 TCTGCTGCTGAGAGACACTTGGG - Intergenic
991857564 5:70982322-70982344 TCTGCTGCTGAGAGACACTTGGG - Intronic
991870722 5:71107201-71107223 TCTGCTGCTGAGAGACACTTGGG - Intergenic
992961081 5:81957125-81957147 GCCGCTGCTCGGAGACATGGTGG - Intergenic
996797293 5:127363012-127363034 GATGCTTCAGGGAGAGAATGAGG + Intronic
997305424 5:132832233-132832255 GATGCTGCTGTGAGACTCTGTGG - Intergenic
997819620 5:137053199-137053221 GCTGCTGCTCAGGGACAAGGAGG + Intronic
998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG + Intergenic
1001049345 5:168402072-168402094 GCTGCTACAGGGTGACAAAGTGG - Intronic
1001575932 5:172763813-172763835 GCTGGTTCAGGGAGACAAAGTGG - Intergenic
1002630601 5:180573263-180573285 GGTGCTGCTGAGAGAAAAGGGGG + Intronic
1003452252 6:6245753-6245775 CTTGCTGCTGGGAAACAGTGAGG - Intronic
1006732377 6:36245880-36245902 GCAGCCGCTGGGAGGCAGTGTGG - Intronic
1010047887 6:71469066-71469088 GCTGCTGCTGGTAACAAATGAGG + Intergenic
1012028508 6:94028913-94028935 ACTGCTGCTGCAGGACAATGTGG - Intergenic
1013638310 6:112049282-112049304 GGTGATGCTGGGAGACGATGGGG - Intergenic
1015355349 6:132271350-132271372 GCTCCTTCTGGAAGACCATGTGG + Intergenic
1017306442 6:152923523-152923545 GCTGCTGCTGCTAGAGAATTGGG - Intergenic
1018429537 6:163712600-163712622 TCTGCTTCTGGGGGAAAATGAGG + Intergenic
1019342968 7:517203-517225 GCCGCCGCTGGGAGAGAAAGTGG + Intronic
1019644792 7:2123367-2123389 GCTACAGCTTGGAGACATTGCGG + Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1020617507 7:10477206-10477228 GCCCCTGCTGGGAGAGAAGGAGG - Intergenic
1020678545 7:11208321-11208343 GCTGTTTCTGGGAGGGAATGTGG + Intergenic
1022448809 7:30494530-30494552 GCTTCTGCCGGGAGCCACTGGGG + Intergenic
1022995736 7:35753559-35753581 GATGATGATGGCAGACAATGTGG - Intergenic
1025858837 7:65307696-65307718 GCTACTGCTTTGAGACAAGGGGG - Intergenic
1026212033 7:68314287-68314309 CCTGCTTTTGGGAGACACTGGGG + Intergenic
1026671248 7:72392457-72392479 GGTGCTGATGGGAGAGACTGAGG + Intronic
1029019129 7:97345842-97345864 GGGGCTGCTGGGAAACAATAAGG + Intergenic
1029853480 7:103489298-103489320 GCTGCTGCTGGAAGAGGCTGAGG + Intronic
1030090072 7:105850655-105850677 GCTTCTGCTGCAAGACACTGTGG + Intronic
1030796435 7:113793515-113793537 ACTGCTGCTGGTAGAGAATCAGG + Intergenic
1031317625 7:120275460-120275482 GCTGGTGATGACAGACAATGAGG + Exonic
1031869964 7:127080733-127080755 CCTGCTACCAGGAGACAATGAGG + Intronic
1032570608 7:132992172-132992194 GCTGCTGCTGGGAAGCAGTGAGG - Intronic
1034064651 7:148124519-148124541 GCTGGTGCTGGGAGGCGCTGGGG + Intronic
1034522071 7:151628148-151628170 CCGGCAGCTGGGAGAGAATGCGG + Intronic
1035097428 7:156366640-156366662 GCTGCAGCGGGGAGAGAAGGAGG - Intergenic
1035403251 7:158582079-158582101 TCTGCTGCTTGGAAACAGTGTGG - Intronic
1035529574 8:340289-340311 GCTGCGGATGGGAGAAAGTGAGG + Intergenic
1036105180 8:5830438-5830460 GCTGCTGCAGTGAGGCAGTGGGG + Intergenic
1036409838 8:8489184-8489206 TCTGCTGCTGTGAGAGAATGAGG - Intergenic
1037616367 8:20522739-20522761 GATGCTGCTGGGAGGGAATGAGG - Intergenic
1039064541 8:33597585-33597607 GCTGCTGCTGGAAGAGGAAGGGG + Exonic
1039116549 8:34097502-34097524 GCTGCTACTGGAAGTCAAAGGGG - Intergenic
1039172952 8:34769440-34769462 GCTGATGCTGGTAGAAAATGGGG - Intergenic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1039900949 8:41752165-41752187 TCAGCTGATGGGAGACACTGGGG - Intronic
1042721345 8:71830101-71830123 ACTGCTCCTGGGAGAAACTGAGG - Intronic
1043005392 8:74811860-74811882 CCTGCAGCTGGGAAACAGTGGGG + Intronic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1043988732 8:86725719-86725741 GGTGCTGCTGAGAGAGAAGGCGG + Intronic
1045184504 8:99823427-99823449 GCAGCTGCTGGGAGACCATGAGG + Intronic
1045643733 8:104280406-104280428 GCTGCTTCAGGGAGGCAAGGGGG + Intergenic
1047702994 8:127469188-127469210 CCTTCTACTGGGAGACAATATGG - Intergenic
1048958275 8:139554822-139554844 GCTGCTGCTTGGATACTTTGGGG - Intergenic
1049040675 8:140110278-140110300 GCTGCTGCAGGGGGAGCATGTGG - Intronic
1049040777 8:140110662-140110684 GCTGCTGCAGGGGGAGCATGGGG - Intronic
1049040849 8:140110880-140110902 GCTGCTGCAGGGGGAGTATGGGG - Intronic
1049100232 8:140574005-140574027 CTTGCTGCTGGGAGAGACTGGGG + Intronic
1049762730 8:144338325-144338347 GCTGCCGCTCGGAGATAAGGGGG - Intergenic
1051253575 9:15188049-15188071 TCTGCTACTGGGAGCTAATGTGG - Exonic
1051953197 9:22660650-22660672 GCTGCTGCACGGAGACAAGATGG + Intergenic
1051984461 9:23066078-23066100 GCTGGTTCCTGGAGACAATGAGG - Intergenic
1053553085 9:39104818-39104840 CCTGCTGCTGCGACACACTGAGG - Intronic
1053663706 9:40302302-40302324 GCTTCTGCATGGAGACAGTGAGG + Intronic
1053663781 9:40302952-40302974 GCTTCTGCTTGGAAACAGTGGGG + Intronic
1053817202 9:41924987-41925009 CCTGCTGCTGCGACACACTGAGG - Intronic
1053914221 9:42932844-42932866 GCTTCTGCATGGAGACAGTGAGG + Intergenic
1053914327 9:42934210-42934232 GCTTCTGCTTGGAAACAGTGGGG + Intergenic
1054107452 9:61068643-61068665 CCTGCTGCTGCGACACACTGAGG - Intergenic
1054375832 9:64448535-64448557 GCTTCTGCATGGAGACAGTGAGG + Intergenic
1054375908 9:64449186-64449208 GCTTCTGCTTGGAAACAGTGGGG + Intergenic
1054520832 9:66073333-66073355 GCTTCTGCTTGGAAACAGTGGGG - Intergenic
1054520907 9:66073983-66074005 GCTTCTGCATGGAGACAGTGAGG - Intergenic
1054613405 9:67262482-67262504 CCTGCTGCTGCGACACACTGAGG + Intergenic
1054870462 9:70043915-70043937 GCTGGTCCTGGGCGACGATGGGG - Exonic
1055723433 9:79201025-79201047 GCTGCTGCAGGGAGACACAGGGG - Intergenic
1056134317 9:83616571-83616593 GTGGCTGTTGGGAGAAAATGGGG - Intergenic
1056320717 9:85432380-85432402 GCTGCTGTTGGTGGACCATGAGG - Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1059911878 9:119053550-119053572 GCAGCTGCTTGAAGACAATAAGG + Intergenic
1060626037 9:125112648-125112670 GTTGCTACTGGGGCACAATGTGG - Intronic
1061120830 9:128641290-128641312 GGTGCTGCTGTGAGCCGATGTGG - Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061897073 9:133653800-133653822 GCTGCTTCCGGGAGCCAAAGGGG + Intronic
1062631995 9:137467246-137467268 GCTGGTGCTGGGGGACGCTGGGG - Intronic
1062636352 9:137493647-137493669 GCAGCTTCTGGGGGACAGTGCGG - Intronic
1186482189 X:9904499-9904521 GGGGCTGCTGGGAAACAAAGGGG - Intronic
1187735670 X:22301537-22301559 ACTCCTGCTGGGAGAAAGTGGGG - Intergenic
1189292364 X:39895385-39895407 GTTGCTGTGGGGAGACCATGTGG - Intergenic
1190753820 X:53383510-53383532 GCTCCTCCTGAGAGACAAAGCGG - Intronic
1192235431 X:69292451-69292473 GCTCCTGCTTGGGGAGAATGAGG + Intergenic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1193812901 X:86072817-86072839 GCTGGGGATGGGAGACAGTGGGG - Intergenic
1193849088 X:86513779-86513801 ACAGCTGCTGGGAGCCAACGAGG - Intronic
1195177058 X:102321996-102322018 GCTGCTCCTAGGAGAAAAAGAGG - Exonic
1195181806 X:102365097-102365119 GCTGCTCCTAGGAGAAAAAGAGG + Exonic
1195840645 X:109172402-109172424 GCTGCTGCAGGGAGGGCATGGGG - Intergenic
1198846209 X:140914504-140914526 CATGCTGCTGGGAGAGAAAGAGG + Intergenic
1199691431 X:150311812-150311834 GCAGCTGCTGGGCGACCAGGTGG - Intergenic
1200234235 X:154460477-154460499 GCTGCTGCTCATAGACTATGCGG + Exonic
1200921200 Y:8615105-8615127 AGTGCTGTTGGGGGACAATGTGG - Intergenic