ID: 1112320037

View in Genome Browser
Species Human (GRCh38)
Location 13:98397414-98397436
Sequence ACTGTTCACCAGAGTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112320037_1112320041 5 Left 1112320037 13:98397414-98397436 CCATTCACACTCTGGTGAACAGT 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1112320041 13:98397442-98397464 CTGTTGGGAATAGTGATACTTGG 0: 1
1: 0
2: 0
3: 11
4: 159
1112320037_1112320039 -10 Left 1112320037 13:98397414-98397436 CCATTCACACTCTGGTGAACAGT 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1112320039 13:98397427-98397449 GGTGAACAGTGTCCTCTGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112320037 Original CRISPR ACTGTTCACCAGAGTGTGAA TGG (reversed) Intronic
902257127 1:15197205-15197227 ACTGTGCCCCAGAGTGTGGGAGG + Intronic
904576842 1:31510323-31510345 ACTGCTCAAGAGAGTGGGAAAGG - Intergenic
904649076 1:31990737-31990759 ACTGTTGACCAGAGTGGTCAGGG - Intergenic
905723000 1:40223408-40223430 ACTGTATACCAGAGTATTAAAGG + Intronic
905810913 1:40912502-40912524 AGAGTTCACCAGAGTGAGGAGGG + Intergenic
907281208 1:53348603-53348625 ACTGTTCACAAGAGAGGGCATGG + Intergenic
909435164 1:75632534-75632556 AATGGTCAGCAGAGGGTGAAGGG - Intergenic
909766442 1:79361738-79361760 ACAGTTCAGCAGAGTGGTAAGGG - Intergenic
914383033 1:147136901-147136923 ACTGTTAGCCAGATTTTGAAAGG + Intergenic
916560500 1:165930755-165930777 ACTGTTCACCAGGGGCTGCAGGG - Intergenic
918370277 1:183853921-183853943 ACTGCTCACAACTGTGTGAAGGG - Intronic
918556127 1:185801511-185801533 ACTGTTAGCCAAAGTGAGAAGGG - Intronic
918928265 1:190816065-190816087 GCTGTCCATCAGAGTGTGGAGGG + Intergenic
920449406 1:206047839-206047861 ATTGTACACCTGAGGGTGAAAGG - Intronic
924632745 1:245757150-245757172 AGTGGTTACCAGAGTGTGAAGGG - Intronic
924681075 1:246234414-246234436 TATGTTCATCACAGTGTGAATGG - Intronic
1063532151 10:6843889-6843911 ACTGTGCAACTGAGTTTGAATGG + Intergenic
1064466026 10:15583003-15583025 AATGTTCACCAATGAGTGAATGG + Intronic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1070396443 10:76015013-76015035 ACTGTACATCAGATTTTGAATGG - Intronic
1070465608 10:76720476-76720498 AGTGTTCATCAGTGGGTGAATGG - Intergenic
1071333152 10:84581251-84581273 AGTGTTCACCAGTGGATGAATGG + Intergenic
1072888019 10:99297362-99297384 CCTCTTCACCAGAGTGGAAACGG - Intergenic
1077519872 11:3026558-3026580 ACTGTTCCCAAGAGTCTGAGGGG + Intronic
1078016040 11:7615782-7615804 AATGTTCACGAGAGTGAGCATGG + Intronic
1081582330 11:44360761-44360783 ATGGTTCACCAGTCTGTGAAGGG - Intergenic
1083673114 11:64310900-64310922 ACTGTTCTTCAGAGTGGGAAGGG - Intronic
1085004749 11:73076292-73076314 AATGTTCACCAGTTGGTGAATGG + Intronic
1087290673 11:96316966-96316988 AGTGTCCACCAGAGTGGGGAGGG - Intronic
1091532965 12:1377220-1377242 ACTGTTCACTAGAGAGTGGACGG - Intronic
1093138756 12:15482108-15482130 AGTGTCCAGCAGAGGGTGAATGG + Intronic
1093664607 12:21796218-21796240 ACTGGTGACCATAGTGTGACTGG + Intergenic
1098284170 12:68891543-68891565 ACTGTTGACTTGTGTGTGAAAGG - Intronic
1099189824 12:79550845-79550867 ACTGTTCACCAGAGTGCCATAGG - Intergenic
1104288388 12:127446451-127446473 CCTGTGCACCAGAGAGTGCAAGG + Intergenic
1107618812 13:42202591-42202613 ACTGTAAATCACAGTGTGAATGG + Intronic
1110160368 13:72370154-72370176 AGTGTTCACCAGTGGATGAATGG - Intergenic
1110590277 13:77248863-77248885 AGTGTTCATCAGTGAGTGAATGG + Intronic
1111048682 13:82849106-82849128 ACAGTCCATCAGAGTGAGAAAGG - Intergenic
1112320037 13:98397414-98397436 ACTGTTCACCAGAGTGTGAATGG - Intronic
1113466913 13:110519532-110519554 ACTCTTCTCCACAGTGTGCAGGG - Intergenic
1116659127 14:47685320-47685342 AGTGTTCATCAGTGTATGAATGG - Intergenic
1117020688 14:51567284-51567306 ACTGGTAACCAGAGGGTCAAGGG - Intronic
1117994263 14:61463958-61463980 AGTGTTCACCAGTGGATGAATGG - Intronic
1118418397 14:65570913-65570935 AATGCTCAGCAGTGTGTGAATGG - Intronic
1119280000 14:73398154-73398176 ACAGTTCACCAAATTGTTAACGG + Intronic
1125606735 15:40943729-40943751 ACTCTTGACCAGAGTGTTAAGGG - Intergenic
1125883901 15:43214384-43214406 ACGGTTCACCAGACTATGAGCGG - Intronic
1127524374 15:59777617-59777639 AATGTTCACCAGGCTGTGTAGGG - Intergenic
1128035806 15:64524891-64524913 ACTGTTTGCCAGAATGTAAATGG + Intronic
1130445825 15:84000885-84000907 AGTGTGGACCAGAATGTGAAGGG + Intronic
1130671473 15:85916818-85916840 ACTGTGCTCCAGAGGCTGAACGG - Intergenic
1134314927 16:13109891-13109913 AATGTTCGCCAATGTGTGAATGG - Intronic
1137806119 16:51307128-51307150 ATTGTTCTCCAGAATGTGGATGG - Intergenic
1139296886 16:65908948-65908970 ACTTTTCACCAGAGTCATAATGG + Intergenic
1141270256 16:82533204-82533226 GCTGTCCACCAACGTGTGAATGG - Intergenic
1142272894 16:89100175-89100197 ACTGCGCACCAGTGTGGGAAGGG + Intronic
1144057431 17:11555509-11555531 ACAGTTCACCATTCTGTGAATGG - Intronic
1150623661 17:66826824-66826846 AATGTTCATCAGTGTATGAATGG + Intergenic
1150959700 17:69900171-69900193 ACTGTTGCCCATAGTGTGGAAGG + Intergenic
1152896123 17:82912410-82912432 ACTGTTCCACAGAGTATTAAAGG + Intronic
1153295420 18:3541383-3541405 ACTGTACACCTGAGTTTTAAAGG - Intronic
1155428069 18:25726617-25726639 CCTGCTCACCAGAGTGGGGAAGG - Intergenic
1158138652 18:54233034-54233056 TCTTTCCACCAGAGTGTGAAAGG - Intergenic
1158793665 18:60814265-60814287 ACTGTTCATCAGTGGATGAATGG - Intergenic
1160155062 18:76427150-76427172 ACATGCCACCAGAGTGTGAAGGG - Intronic
1166658016 19:44626495-44626517 AGTGATCACCAGAGTGGGCAGGG + Intronic
1168479191 19:56703901-56703923 ACTGTTAAACAGGGTATGAAAGG + Intergenic
925666682 2:6264362-6264384 AGTGTTCAGAAGAGTGTGAGGGG + Intergenic
926445292 2:12934493-12934515 ACTGTAAAACAGAGTCTGAAGGG - Intergenic
927528258 2:23768899-23768921 AATGTCCACCAGCATGTGAATGG - Intronic
931461551 2:62454438-62454460 ACTGCTCCCCAGAATGTAAAAGG + Intergenic
933077381 2:77946139-77946161 ACTGCTCACCTTAATGTGAAAGG + Intergenic
934523197 2:95032716-95032738 ACCTTTCACCAGGGTGTCAAAGG - Intronic
934559576 2:95306069-95306091 ACTGTTCTCCAGAGTGGCTAAGG + Intronic
938545465 2:132325445-132325467 AATGTTCACCAACGTGAGAATGG - Intergenic
939648250 2:144728996-144729018 ACATGTCACCAGAGTGTCAAAGG - Intergenic
943319040 2:186424426-186424448 CCTGTTCAACAGGGTGTGAGAGG + Intergenic
944960170 2:204863340-204863362 ACTCCTCACCAGAGTAAGAAAGG - Intronic
947464409 2:230328287-230328309 ACTCTTCACAAGACTGTGAAAGG - Intronic
948339222 2:237235651-237235673 AGTGTTCAGCACAGTGTAAATGG + Intergenic
1170714789 20:18822299-18822321 ACTGTGCACAACAGTGTGGATGG - Intronic
1171874323 20:30558201-30558223 AATGTTCACCAACGTGAGAATGG - Intergenic
1172707239 20:36891272-36891294 ACTCTTCACCCCAGTGTGGACGG + Exonic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1174368132 20:50068634-50068656 AGTGTCCCCCAGATTGTGAATGG + Intergenic
1174380185 20:50151291-50151313 GCTGTTCTTCAGAGAGTGAAGGG + Intronic
1174920260 20:54694553-54694575 ACTGTTCTCCTGAGAGTGAACGG - Intergenic
1175948638 20:62570547-62570569 ACAGTGCTCCAGTGTGTGAAGGG + Exonic
1177331257 21:19666520-19666542 ACTATTCACCAGAGTGTACAGGG + Intergenic
1177459335 21:21389809-21389831 AGTGTTCACCAGTGCATGAATGG - Intronic
1183222068 22:36521553-36521575 AATGTTCATCAGCATGTGAATGG + Intronic
950609899 3:14119705-14119727 ACTGTGCACCAGAGGGTTTAAGG - Intronic
950788495 3:15454501-15454523 ACTGTGCACCAGAGGCAGAAGGG + Intronic
954806643 3:53224545-53224567 CCTGTTCACCAGTGTGTTGAGGG - Intergenic
955233914 3:57123179-57123201 AATGCTCAGCAGAGAGTGAATGG - Intronic
956248867 3:67214762-67214784 ACTCATTACCAAAGTGTGAAGGG + Intergenic
956938730 3:74132969-74132991 GCTGTTCTCCTGAGAGTGAATGG - Intergenic
957013421 3:75034576-75034598 ACTGATCAATAAAGTGTGAAAGG - Intergenic
959153790 3:102641275-102641297 AGTGCTCAACAGAGTGTAAATGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962461208 3:135614520-135614542 AATGTCCACCAAAGTGAGAATGG + Intergenic
962548438 3:136462293-136462315 AGTGTTCACCAGCGTTTGAATGG + Intronic
964516446 3:157513788-157513810 ACTAATCACCAGGGTGTTAAAGG + Intronic
965400407 3:168206412-168206434 ACTGTTCCCCAGACTGAAAAGGG + Intergenic
965422443 3:168478801-168478823 ACTGTTCAGAAGAGTCTGAATGG + Intergenic
965601275 3:170456985-170457007 ACTGTCCACCAATGAGTGAATGG - Intronic
968229024 3:196993565-196993587 TCTGTTCACCAAACTGTTAACGG - Intronic
968381981 4:104243-104265 GCTGGTGGCCAGAGTGTGAAGGG - Intergenic
973617335 4:52691915-52691937 AGTGTTCACAAGAGTCTGATGGG - Intergenic
976623652 4:87155257-87155279 AGTGTTCACCAGTGCATGAATGG + Intergenic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
985971221 5:3380274-3380296 ACTGTTCCACAGAGAGTTAAGGG - Intergenic
986190483 5:5492344-5492366 AATGGTCAACAGAGTGTGGACGG + Intergenic
988050146 5:26017215-26017237 AGTGTTCACCAGTGGGTAAATGG + Intergenic
989084596 5:37662244-37662266 CCTGTTCACCTGAGTTTTAAAGG - Intronic
991931647 5:71758727-71758749 AGTGTTCACCAGTGGATGAATGG - Intergenic
997621616 5:135302338-135302360 ACTGTTCATCAGTAAGTGAATGG + Intronic
998036620 5:138922664-138922686 ACTGTTCAACAGAGGGGGACAGG - Intronic
1000441461 5:161269038-161269060 ACTGTTCATCAGTGGATGAATGG - Intergenic
1002890734 6:1329503-1329525 ACTGTTCATCAGTGGATGAATGG - Intergenic
1005733625 6:28723305-28723327 ACTCTTCCCTTGAGTGTGAATGG - Intergenic
1010108896 6:72201562-72201584 TCTGATCAACAGTGTGTGAAAGG - Intronic
1014888446 6:126811819-126811841 ACTGTGCACCATCGTATGAAGGG + Intergenic
1015205102 6:130628745-130628767 AGTGTGCACCAGAGTGTGCAGGG + Intergenic
1015322376 6:131890602-131890624 ACTGTCGACCAGAGTTAGAACGG + Exonic
1015449136 6:133343602-133343624 ACAGTCTACCAGAGTGTGTATGG - Intronic
1018476813 6:164150713-164150735 CCTGTCCACCAGGGTGTGGAGGG + Intergenic
1019172568 6:170141981-170142003 AGTGTTCATCAGTGGGTGAACGG - Intergenic
1019317982 7:400077-400099 ACTGGGCACCAGAAAGTGAAGGG - Intergenic
1021384708 7:20014606-20014628 ACTGTTGGTGAGAGTGTGAAAGG + Intergenic
1021672907 7:23050205-23050227 AATGTTCATCAGCTTGTGAAGGG - Intergenic
1021819647 7:24483943-24483965 AATGTTCACCAAAGTGTTAACGG - Intergenic
1024425813 7:49225563-49225585 AATCTCCAGCAGAGTGTGAAAGG + Intergenic
1024852164 7:53731525-53731547 ACTGCTAACCAGGGGGTGAAAGG - Intergenic
1030439188 7:109564541-109564563 ATTGTATACCAGAGAGTGAATGG + Intergenic
1033676843 7:143549875-143549897 ATTGTTCATCAGTGGGTGAATGG - Intergenic
1033694992 7:143779560-143779582 AGTGTTCATCAGTGGGTGAATGG + Intergenic
1039185827 8:34915336-34915358 TCTTTTCACTAGAGTATGAAAGG - Intergenic
1041544218 8:59023311-59023333 ACAGCTCATGAGAGTGTGAAAGG - Intronic
1043520946 8:81044681-81044703 GCTGTGCATCAGTGTGTGAAAGG - Intronic
1044436634 8:92171838-92171860 ATGGTCCACCAGAGTGAGAAAGG - Intergenic
1045039441 8:98208099-98208121 ACTGTACAACAGAGTGTGACTGG - Intronic
1046061686 8:109147643-109147665 ACTTTTCTCAAGAGAGTGAAAGG + Intergenic
1047089414 8:121557125-121557147 ACTATTGACCAGAGTGAGCAAGG + Intergenic
1047366165 8:124213659-124213681 ACATTGCACTAGAGTGTGAAGGG + Intergenic
1047593970 8:126357605-126357627 ACTTTTTACCATAGTGTTAAAGG - Intergenic
1048918602 8:139207360-139207382 ATTGTAAACCAGAGAGTGAAGGG + Intergenic
1053282246 9:36828046-36828068 TCTGGTCACTAGAATGTGAATGG + Intergenic
1056075602 9:83035436-83035458 CCTGTTCATCTGAGTGTGGAAGG - Intronic
1057723321 9:97550262-97550284 ACTGTTTACCAGTGGATGAATGG - Intronic
1059276005 9:113097738-113097760 ACTCTTCTCCATAGGGTGAATGG - Intergenic
1059546879 9:115185034-115185056 ACTGTCCACCAAAGGGAGAATGG - Intronic
1060799621 9:126535298-126535320 GCTGTTCAGCAGGGTGTGACAGG - Intergenic
1060945538 9:127568004-127568026 ACTGTTCTCCAGAGTCTGTGGGG + Intronic
1061911092 9:133724993-133725015 AATGTCCACCAGTGGGTGAACGG + Intronic
1062206268 9:135339161-135339183 ACTGTGCACTAGAGAGTGAGAGG + Intergenic
1186444532 X:9615436-9615458 ACTTTTCACCAGAATGAGGATGG - Intronic
1188937100 X:36190095-36190117 ACTGTTCACCTGGGAGTGAAAGG + Intergenic
1190248181 X:48704551-48704573 ACTGTTCTCCAGGAGGTGAAGGG + Intronic
1194283677 X:91983638-91983660 ACTGTTCTCCTGACAGTGAATGG - Intronic
1194296859 X:92136748-92136770 ACTTTTAATCAGAGTGTGACGGG + Intronic
1196078559 X:111605792-111605814 CCTGTTCACCAAAGAGGGAATGG + Intergenic
1196437443 X:115687827-115687849 ACTGTGCACCAGAATAAGAATGG - Intergenic
1197282603 X:124554384-124554406 ACTGTTCACCACTGTATGACTGG - Intronic
1199132813 X:144213025-144213047 ACTGCTAAGCAAAGTGTGAAAGG - Intergenic
1199544524 X:148993915-148993937 TCTGTTCATCACAGTGTAAATGG + Exonic
1199932359 X:152536498-152536520 ATTGTTCAGGAGAGTTTGAAAGG + Intergenic
1200601248 Y:5208202-5208224 ACTGTTCTCCGGACAGTGAATGG - Intronic
1200896202 Y:8378419-8378441 ACTATTCCCCACTGTGTGAAAGG + Intergenic