ID: 1112321728

View in Genome Browser
Species Human (GRCh38)
Location 13:98414000-98414022
Sequence GCCAGCCAAAGCCACCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112321728_1112321730 -10 Left 1112321728 13:98414000-98414022 CCTTCATGGTGGCTTTGGCTGGC 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1112321730 13:98414013-98414035 TTTGGCTGGCTCCCCATTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 107
1112321728_1112321731 -9 Left 1112321728 13:98414000-98414022 CCTTCATGGTGGCTTTGGCTGGC 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1112321731 13:98414014-98414036 TTGGCTGGCTCCCCATTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112321728 Original CRISPR GCCAGCCAAAGCCACCATGA AGG (reversed) Intronic
902598034 1:17522316-17522338 GCCAGCCAACGCCGTCCTGAAGG + Intergenic
902628545 1:17690785-17690807 GCCAGCCCCAGCCACCATGCTGG + Intronic
902779284 1:18693956-18693978 CCCAGGCAAAGCCATCCTGAGGG + Intronic
902888144 1:19421589-19421611 GTCAGCCAAGGCCACAGTGATGG + Intronic
903379558 1:22887261-22887283 GCCAGCCACCACCACCAGGAAGG + Intronic
903849699 1:26298462-26298484 GCCAGACAAAGCCAGAATGCGGG + Intronic
904378608 1:30096677-30096699 GCCAGCCACAGCTACCATATGGG + Intergenic
904596212 1:31647332-31647354 ACCAGCCAAAGCCAACATCCAGG - Intergenic
905255404 1:36678577-36678599 GCCAGACAAAGCTTCCATGGGGG + Intergenic
907192209 1:52658910-52658932 GCCAGCCAAAGGGTACATGATGG + Intronic
907296030 1:53455170-53455192 GACAGCCACAGCCATCATGGAGG + Intergenic
907944728 1:59125174-59125196 GCCAGCCAATGCAACCTTGATGG + Intergenic
908561192 1:65309065-65309087 TTCCGCCAAAGCCACCAGGACGG - Intronic
910929350 1:92427655-92427677 GCAAATCAAAACCACCATGAGGG + Intergenic
912801254 1:112720909-112720931 GCCTCCCAAAGCTACCCTGAAGG - Intronic
915349530 1:155215694-155215716 TCCAGCCAAAGCCACCCTAAGGG - Intergenic
915352725 1:155236376-155236398 TCCAGCCAAAGCCACCCTAGGGG - Exonic
917501272 1:175587587-175587609 GCCAGTCAAAGCAACAATCAAGG + Intronic
917916087 1:179703526-179703548 GTCATCCAAAACCACCAGGATGG - Intergenic
920097738 1:203497581-203497603 GCCAGCCGCAGCCTCCAGGAGGG - Intronic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
921056551 1:211546946-211546968 GCCAGCAAAGGACACCACGAAGG - Intergenic
923910254 1:238433222-238433244 GCTATCTAAAGCCAACATGAAGG + Intergenic
924637519 1:245802672-245802694 GCCACCAACAGGCACCATGAGGG - Intronic
924757289 1:246952951-246952973 GCCAGTCTCAGCCACAATGAAGG + Intronic
1062767005 10:73843-73865 ACCCGCCCAAGCCACCATGAAGG + Intergenic
1064952910 10:20874303-20874325 GACAGCCTAAGTCAACATGAAGG - Intronic
1066416172 10:35223730-35223752 GCCAGTCAGTGCCACCAGGAGGG - Intergenic
1068702732 10:60037138-60037160 CCCAGCTGAAGCCACCATTATGG + Intronic
1069866099 10:71503854-71503876 CCCAGCCAAAGGCACAATCAGGG + Intronic
1070735688 10:78862146-78862168 TCCATCCACAGCCACCATGTGGG + Intergenic
1070772016 10:79088128-79088150 GCCAGCCAAAGCCAGAGAGATGG + Intronic
1074459577 10:113624992-113625014 ACCAGACAGAGACACCATGAGGG - Intronic
1075841435 10:125508171-125508193 GGAAGTGAAAGCCACCATGAAGG - Intergenic
1075862664 10:125690619-125690641 TACAGCCAAAGCAAACATGAGGG - Intergenic
1077919523 11:6632235-6632257 GACAGGCACAGCCACCGTGAGGG - Exonic
1078687855 11:13549701-13549723 GCCAGCCACAGCCACTGTGGGGG + Intergenic
1079771202 11:24461932-24461954 GCCAGGCATGTCCACCATGAGGG - Intergenic
1081317016 11:41642077-41642099 CCCTGCCACAGCCACCATGTGGG + Intergenic
1081390636 11:42524778-42524800 GCCTGCCACAGCCACTATGAAGG + Intergenic
1087155179 11:94895052-94895074 TCAAGCCAAAGCCACCCTGTAGG + Intergenic
1087515419 11:99154074-99154096 GCCAGCCAAAGCCTTCACCAGGG + Intronic
1089441569 11:118522214-118522236 GCCATCCAAAGCAACGCTGAAGG + Exonic
1089877993 11:121744519-121744541 GCCAGCTCAAGCCACCATAGTGG - Intergenic
1090605958 11:128423153-128423175 GACAGCCACAGCCCCCATGCAGG + Intergenic
1090853558 11:130592275-130592297 GCAGGGGAAAGCCACCATGAAGG + Intergenic
1090985290 11:131761010-131761032 CCCAGCCAAAACCACCGGGATGG + Intronic
1091226430 11:133958989-133959011 GCCAGACAAAGCAATCAAGATGG - Intergenic
1094844804 12:34356760-34356782 GCCAGCCCAAGGCAGCAGGAAGG - Intergenic
1094845751 12:34360718-34360740 GCCAGCCCAAGGCAGCAGGAAGG - Intergenic
1094846188 12:34362399-34362421 GCCAGCCAAAGAGAGCAGGAAGG - Intergenic
1094847050 12:34365939-34365961 GCCAGCCCAAGGCAGCAGGAAGG - Intergenic
1094849401 12:34375660-34375682 GCCAGCCAAAGGCGGCAGGAAGG - Intergenic
1094852682 12:34389286-34389308 GCCAGCCCAAGGCAGCAGGAAGG + Intergenic
1094853162 12:34391351-34391373 GCCAGCCGAAGACAGCAGGAAGG + Intergenic
1094853341 12:34392102-34392124 GCCAGCCCAAAGCACCAGGAAGG + Intergenic
1094853384 12:34392287-34392309 GCCAGCCAAAGGCAGCAGGAAGG + Intergenic
1094853432 12:34392477-34392499 GCCAGCCCAAGTCGTCATGAAGG + Intergenic
1094855367 12:34400497-34400519 GCCAGCCCAAGGCAGCAGGAGGG + Intergenic
1094855589 12:34401435-34401457 GCCAGCCGAAGGCAGCAGGAAGG + Intergenic
1094856294 12:34404359-34404381 GCCAGCCCATGGCACCAGGAAGG + Intergenic
1096755516 12:53796309-53796331 TGCAGGCAAAGCCACCTTGACGG + Intergenic
1099847633 12:88048242-88048264 GCCAGCATAAGCCAAGATGATGG - Exonic
1101140069 12:101786126-101786148 GCCAGCCAACATCACCCTGAAGG - Exonic
1102146518 12:110658751-110658773 GCCTGCCAAATCCTCAATGAGGG + Intronic
1102504286 12:113374014-113374036 GCCTGCCCAAGGCCCCATGAGGG + Intronic
1104048392 12:125180302-125180324 GACAGCCAAATCAACCATCACGG - Intergenic
1105774873 13:23649039-23649061 GCCAGATAAAGCTGCCATGAGGG - Intronic
1106708983 13:32311413-32311435 GCCAGCCGCAGCCACCATCACGG - Exonic
1109046444 13:57418359-57418381 CCCACCCAAATCCACCTTGAAGG - Intergenic
1111385166 13:87516869-87516891 GAAAGCCAAAGCCACCAGAAGGG - Intergenic
1112321728 13:98414000-98414022 GCCAGCCAAAGCCACCATGAAGG - Intronic
1112851163 13:103708330-103708352 ACCAGCCAATGCCACCAGGTTGG + Intergenic
1113662778 13:112118428-112118450 CCCAGCCCAAGTCACCCTGAAGG - Intergenic
1114414341 14:22530227-22530249 CCCAGCCAGAGCTCCCATGAGGG + Intergenic
1119425343 14:74531446-74531468 ACCTGCCACTGCCACCATGAAGG + Intronic
1119503956 14:75155390-75155412 GCAAACCAAAACCACTATGAAGG - Intronic
1120563040 14:86019808-86019830 GTCAGCCAATGCCATGATGAGGG + Intergenic
1120687251 14:87551939-87551961 GCCAGACAAAGACACCATAACGG + Intergenic
1120859407 14:89241409-89241431 TCAACCCAAAGCCACCATGGTGG + Intronic
1121719114 14:96097034-96097056 ACCAGCCAAAGTCTGCATGAGGG + Intergenic
1122396663 14:101437640-101437662 GCCAGCCAAGGTCAGCAGGATGG - Intergenic
1123118743 14:105907297-105907319 GCCAGCCAGAGCCAGCAAGATGG - Intergenic
1127556196 15:60089736-60089758 ACCAGCCACAGTCACCATGCTGG - Intergenic
1128486895 15:68101198-68101220 GCAAACTAAAACCACCATGAAGG - Intronic
1128720070 15:69941620-69941642 GCCAGACAATGTCCCCATGACGG - Intergenic
1129024323 15:72554964-72554986 GCAAATCAAAACCACCATGAAGG - Intronic
1129222667 15:74141004-74141026 GCCATCCAAAGGCCCCATGATGG + Intergenic
1130388665 15:83435423-83435445 GTCAGGCAAAGCCACAAGGATGG + Intergenic
1130894590 15:88160262-88160284 GCCAGCCAGAGCCACACTCAAGG + Intronic
1132455988 16:23190-23212 ACCCGCCCAAGCCTCCATGAAGG - Intergenic
1133339437 16:5027160-5027182 GCCACCTGAAGCCACCCTGAGGG - Exonic
1137551335 16:49439768-49439790 GACTTCCAATGCCACCATGAGGG + Intergenic
1137792958 16:51190358-51190380 ACCAGCCAAAGGCACCACGAAGG - Intergenic
1141778642 16:86141888-86141910 GCCAACCAAACCCACCAGGTGGG + Intergenic
1142112716 16:88340829-88340851 GTCAGGCAGAGCCACCCTGAGGG + Intergenic
1142439021 16:90082424-90082446 ACCAGCCCAAGCCCTCATGAGGG - Intronic
1143524305 17:7463319-7463341 GCCAGCCATGGCCACCACCACGG - Exonic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1150499543 17:65637431-65637453 GACAGGTAAAGCCACAATGATGG - Intronic
1151186286 17:72366368-72366390 CCCAGCCAAACCCAGCAAGAGGG - Intergenic
1152133655 17:78491818-78491840 GCCAGCCAGGGCCACAAAGAGGG - Intronic
1153143620 18:2002839-2002861 GCCAGGCATATCCACCATGCGGG + Intergenic
1154975821 18:21456566-21456588 GTCAGTCACAGCCACCAAGAGGG - Intronic
1156303025 18:35852043-35852065 GTCAGCCACAGCCACCATCATGG + Intergenic
1156407764 18:36799042-36799064 GCCACAAAAAACCACCATGAAGG + Intronic
1156941917 18:42778077-42778099 GCCAGCCATAGGCAGCATGAGGG - Intronic
1158607788 18:58911283-58911305 GCTTGGCAAAGCCAGCATGAAGG + Intronic
1159551914 18:69904163-69904185 ACCCGACAAAGCCATCATGAAGG + Intronic
1161353077 19:3804409-3804431 GCCAGCCAAGGCCTACATCAGGG + Exonic
1163674989 19:18651247-18651269 GCCTGCCAACACCACCAGGAAGG + Intronic
1164304875 19:23997321-23997343 GCCAGCCAGAGCCATCTGGACGG + Intergenic
1166530588 19:43540867-43540889 GCCTACCAAAGCCACCATGTGGG - Intergenic
925171545 2:1753082-1753104 GCCAGCCAAAACCAAGATGGTGG + Intergenic
927198776 2:20565742-20565764 CCAAGCCAAAGCCACCAGGCAGG + Intronic
929629480 2:43444852-43444874 GGCAAGCAAAGCCACCATGTAGG + Intronic
931360207 2:61571542-61571564 CCCTCCCAAAGCCACCATGCTGG - Intergenic
934164014 2:89278024-89278046 GCCAGACAAACCCTCCATGAGGG + Intergenic
934165477 2:89290309-89290331 GCCACCCACACCCTCCATGAGGG - Intergenic
934201797 2:89892153-89892175 GCCACCCACACCCTCCATGAGGG + Intergenic
934203260 2:89904500-89904522 GCCAGACAAACCCTCCATGAGGG - Intergenic
934620266 2:95799269-95799291 GGCAGCCAGGGCCATCATGAGGG + Intergenic
934709686 2:96506824-96506846 GCCACCCAAAGCCAGCAGGCTGG + Intronic
939180178 2:138794909-138794931 GCCAGCCAATGGCAACAGGATGG - Intergenic
941622864 2:167798003-167798025 GCAAACCAAAACCACAATGAGGG - Intergenic
941720322 2:168805757-168805779 TCCAGGCTAAGCCACCAAGATGG - Intronic
942103542 2:172610399-172610421 GCCAGCACCAGCCACCATGGTGG + Intergenic
942211102 2:173671148-173671170 GCCAGCCAAATGCACCCTGTAGG - Intergenic
942260777 2:174160664-174160686 GCCAAACAAAGCCACAAAGACGG - Intronic
948865425 2:240772511-240772533 TCCAGCCCCAGCCAGCATGAGGG - Intronic
1168941398 20:1714365-1714387 GCTATCTAAAGCCAACATGAAGG + Intergenic
1171962262 20:31503342-31503364 GCCTCCCAAAGCCACCACGGTGG + Intergenic
1172739934 20:37158401-37158423 GTCAGGCAAAGCCTTCATGATGG - Intronic
1173988100 20:47278415-47278437 GCTATCCAAAGCAACCATGTAGG + Intronic
1175096240 20:56543679-56543701 GCCAGGGAGAGCCACCCTGAGGG - Intergenic
1175312582 20:58021793-58021815 TCCAGCCAAAGCCACGTGGAGGG - Intergenic
1177086531 21:16711983-16712005 GTCTGCCAAAGCCAGCAGGAGGG + Intergenic
1181851139 22:25750779-25750801 GCCAGCCAATGTCACCCTGCAGG - Intronic
1182518836 22:30873803-30873825 GCCAGACAAAGCCCACATGGAGG + Intronic
1184938241 22:47740488-47740510 GCCTGACAAACCCTCCATGAAGG + Intergenic
949475571 3:4442013-4442035 CCCAGCCACAGACACCATGCAGG - Intronic
949661317 3:6282497-6282519 GGCAGCTGAAGCCTCCATGAAGG + Intergenic
950574718 3:13825301-13825323 GCCAGCCATGGAAACCATGAGGG - Intronic
953563789 3:44014170-44014192 GCCAGCCAGAGCAACCCTGCAGG - Intergenic
954303758 3:49714799-49714821 GCCAAGAAGAGCCACCATGAAGG - Intronic
955046985 3:55369869-55369891 GCCAGCCACAGCCACCAGACTGG + Intergenic
955560322 3:60182186-60182208 GCCAGCCAAAACTACCAGGTGGG - Intronic
960875287 3:122289598-122289620 GCCGGGCAGAGCCAGCATGAAGG + Intergenic
961208763 3:125109147-125109169 GCCAGCCACAGAAACCAAGAAGG - Intronic
963358532 3:144240377-144240399 GCCAGCCAAACACACTTTGAGGG - Intergenic
965838869 3:172880874-172880896 ACCCCGCAAAGCCACCATGATGG + Intergenic
968263450 3:197343657-197343679 GCCAGCAAACAACACCATGAAGG + Intergenic
968495430 4:912688-912710 GCCTGCCAAAGCCACCGTGCTGG + Intronic
968502294 4:956318-956340 GCCAGCCAAAGGGAGCAGGAGGG - Intronic
968918995 4:3512866-3512888 GCCAGCCCCAGCCACCCTGACGG + Exonic
970955813 4:21810089-21810111 GACAGAGAAAGACACCATGAAGG + Intronic
971475660 4:27069305-27069327 GCCAAGCAAAGCCACCATATAGG - Intergenic
972096203 4:35350047-35350069 GCCAGCAAAAGCAAGCATGGGGG - Intergenic
972328044 4:38036670-38036692 GACTGCCAAAGCCACCTAGAAGG - Intronic
976461012 4:85313011-85313033 GCTATCCAAAGTCAACATGAAGG - Intergenic
978203437 4:106050252-106050274 AACAGACAAATCCACCATGATGG + Intronic
978385318 4:108171808-108171830 ACCAAGCAAAGCCACCAGGAGGG - Intergenic
978434018 4:108663860-108663882 GACAGGAGAAGCCACCATGAAGG - Intronic
979305387 4:119136564-119136586 GCAAGCAACAGCCATCATGAAGG + Exonic
979639072 4:122990863-122990885 GCCGGCGCAAGCCACCATGCTGG + Intronic
981633674 4:146850415-146850437 GCCTGACAATGCCACCATGCAGG + Intronic
981669879 4:147274970-147274992 GCCTGCCCAAGCCACCAGGCTGG - Intergenic
986653474 5:9988134-9988156 GCAAGCCAAAGACACCTTGGGGG - Intergenic
988716482 5:33834052-33834074 GCCATCTAAAGCCACCAAGCAGG - Intronic
989149570 5:38285523-38285545 GCCAGCCCAAGCTACCTTCAGGG + Intronic
990777950 5:59324379-59324401 CTCAGCCCCAGCCACCATGAGGG + Intronic
991302646 5:65144369-65144391 GCCAGCCAAAGCCCCGTTGGTGG + Intergenic
994729206 5:103472060-103472082 GCCAGCCGATTCCACCATGGTGG + Intergenic
995402799 5:111760491-111760513 GACAGCCAAAGCCAAAGTGAAGG + Intronic
998283613 5:140836360-140836382 GACAGCCACAGCCACCGTGCTGG + Exonic
1000360140 5:160439362-160439384 AACAGCCAAAGCCACCACGGAGG - Intergenic
1005842811 6:29755307-29755329 TCAACCCAAAGACACCATGACGG - Intergenic
1010139494 6:72597901-72597923 GCCAGCCATGTCCACCATGGGGG + Intergenic
1012079598 6:94738490-94738512 GCTATCTAAAGCCAACATGAAGG + Intergenic
1014480223 6:121927228-121927250 CCCAGACAAAGCCACTATGTTGG - Intergenic
1016357413 6:143233218-143233240 GCGAGGCAGAGCCACCCTGATGG - Intronic
1019306632 7:338573-338595 GCCAGCCAAAGCCCTCCTGCCGG + Intergenic
1019510179 7:1413894-1413916 GACAGCCACAGGCACCAGGAAGG - Intergenic
1019860290 7:3652415-3652437 GCCACCGCATGCCACCATGAAGG - Intronic
1020793849 7:12659499-12659521 GATATCTAAAGCCACCATGATGG + Intergenic
1021682553 7:23149137-23149159 CACAGCCAAAGCCACCACAAAGG + Intronic
1024250030 7:47499154-47499176 ATCAGCCAAGGCCACCATGTGGG - Intronic
1024293748 7:47826699-47826721 GCCATCCAGCACCACCATGATGG + Intronic
1024361461 7:48473234-48473256 GCCAGGCACATCCACCTTGAAGG - Intronic
1028764383 7:94535471-94535493 GCCATCCAAAGATTCCATGATGG - Exonic
1029403517 7:100359448-100359470 GACAGCCAATGCAACCCTGATGG - Exonic
1030618684 7:111766105-111766127 GCCTGCCAGAGTCAACATGATGG + Intronic
1030737419 7:113066358-113066380 GCCATCCAAAGTGACAATGAAGG + Intergenic
1032497923 7:132376726-132376748 CCAGGCCAAAGCCACCATCAGGG - Intronic
1033271415 7:139936133-139936155 GGGAGCCAAAGCCACCTTGGTGG - Intronic
1034423492 7:151001230-151001252 GCTAGCCAAAGTCACCATCGTGG + Exonic
1035054282 7:156023550-156023572 GCCCACCAAACACACCATGAGGG - Intergenic
1035060725 7:156067311-156067333 GCCAGCCACAGCCCCCATTTCGG - Intergenic
1035962125 8:4148821-4148843 ACAAGCCAAAGGCAGCATGAGGG - Intronic
1036556175 8:9862284-9862306 GCCAGCCTCAGCCAGCATGCAGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1040334526 8:46409317-46409339 GCCTGCCAACGCCACCCTGCGGG - Intergenic
1044942087 8:97353793-97353815 CACCTCCAAAGCCACCATGACGG + Intergenic
1049581034 8:143411093-143411115 GCCAGGCAGAGCCCTCATGAAGG - Intergenic
1057794535 9:98145996-98146018 GCCAGCCTTAGCCAGCATGGTGG - Intronic
1059745283 9:117194168-117194190 GCCAGGCAAGGCCCACATGAGGG - Intronic
1061077330 9:128349608-128349630 GCCAGCCCTAGGCACTATGAGGG - Intronic
1062340332 9:136091216-136091238 GCCAGCCCCAGCCGGCATGAAGG + Intronic
1062351789 9:136143168-136143190 CCCAGCCCAAGCCGCCAGGACGG + Intergenic
1062738228 9:138150412-138150434 ACCCGCCCAAGCCGCCATGAAGG - Intergenic
1062738241 9:138150474-138150496 ACCCGCCCAAGCCGCCATGAAGG - Intergenic
1188543008 X:31270313-31270335 TCCAGCCAAAGCCACCCTCTGGG + Intronic
1188970822 X:36613292-36613314 GCCAGCCCAAGCGTCCATGGTGG - Intergenic
1192277513 X:69648631-69648653 GCCAGCCAAAGGCAACAGGCTGG - Intronic
1200400381 X:156016535-156016557 ACCCGCCCAAGCCTCCATGAAGG + Intergenic