ID: 1112321820

View in Genome Browser
Species Human (GRCh38)
Location 13:98414880-98414902
Sequence CCCATCAGGTACCTGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112321815_1112321820 29 Left 1112321815 13:98414828-98414850 CCATTAAAACAAAATGACTGGAT 0: 1
1: 0
2: 1
3: 31
4: 325
Right 1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 130
1112321817_1112321820 -7 Left 1112321817 13:98414864-98414886 CCAAAGCATGATGGCTCCCATCA 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112321820 Original CRISPR CCCATCAGGTACCTGCAGTC TGG Intronic
900633295 1:3649926-3649948 CTCACCAGGTACTTGCCGTCCGG + Exonic
902041509 1:13495879-13495901 CCCCTCAGGTGCCTGCAGACAGG + Intronic
902781626 1:18708742-18708764 CCCTTCAGGGATCTCCAGTCTGG + Intronic
903393890 1:22984510-22984532 CCCAGCAGGCACCTGTAATCGGG + Intergenic
904007434 1:27370813-27370835 CCCAGCAGGGTCCTGGAGTCTGG - Intronic
904761318 1:32806470-32806492 CCCCTTAAGTACCTGCAGTCCGG + Exonic
904918745 1:33989815-33989837 CAGATCAGTTACCTGCGGTCAGG + Intronic
906528048 1:46507972-46507994 CCTATGAGGGACCGGCAGTCTGG + Intronic
913264840 1:117034104-117034126 CCCAAGAGGCACCTGCAGCCAGG + Exonic
913340899 1:117757380-117757402 CCCCTCAGCTCCCTGCAATCTGG - Intergenic
915908340 1:159896192-159896214 CCCTGGAGGAACCTGCAGTCTGG - Intronic
916943687 1:169702487-169702509 GCCAACAGGTACCTTCTGTCTGG - Intronic
1062968470 10:1628118-1628140 CCCCTCAGGCACCTGCTGCCAGG - Intronic
1063842777 10:10090728-10090750 CCCATAAGGTATCAGCAGTTAGG - Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1067925816 10:50507002-50507024 CCCATTCGGTACCAGCATTCTGG - Intronic
1069246876 10:66217891-66217913 TTCATCTGGTACCCGCAGTCTGG - Intronic
1069834894 10:71302175-71302197 CCCACCAGGTACATGCCCTCGGG - Exonic
1073141175 10:101249105-101249127 CCCAGCTGCTAACTGCAGTCCGG - Intergenic
1074738858 10:116464896-116464918 CGCATCAGGAAGCTGCAGTGGGG - Intronic
1076422354 10:130340394-130340416 CCGATCAGGAACCTGCCCTCTGG - Intergenic
1076791705 10:132780260-132780282 CCCAGCAGGTGCCTGTATTCCGG - Intronic
1077080096 11:721277-721299 CCCATCAGGTTTCCGCCGTCGGG + Exonic
1077140964 11:1024674-1024696 CACATCAGGGCCCTGCACTCAGG + Intronic
1077174291 11:1181631-1181653 CCCACCAGCCACCTGCAGTGGGG + Intronic
1080665233 11:34330113-34330135 CCCAGCAGGGACCAGAAGTCAGG - Intronic
1081671831 11:44946836-44946858 CCCAGCAGGGACCTGGAGTGTGG - Intronic
1082786601 11:57320615-57320637 CCCAACAGGCACCAGCAGGCTGG + Exonic
1083955657 11:65981587-65981609 CCCCTCAGGTACCTGAGGGCAGG - Intergenic
1084964893 11:72739362-72739384 CCCATCAGCCACCAGCACTCCGG - Intronic
1086119853 11:83294472-83294494 CCAATCAGGTACCTTGAGGCTGG - Intergenic
1089121550 11:116139159-116139181 CACATGAGGCAACTGCAGTCTGG - Intergenic
1090386630 11:126361109-126361131 ACCTTCAGGTCCCTGCAGACAGG + Intronic
1097914528 12:65006454-65006476 TCCTTCAGGCACCTGCAGTCAGG - Intergenic
1098386649 12:69926727-69926749 ACAATCAGGTACGTGCAGCCAGG + Intronic
1101493242 12:105229667-105229689 CCCAGCAGGAACCAGCAGTCTGG + Intronic
1102099919 12:110270344-110270366 CCCATCTGGCTCCAGCAGTCTGG - Intergenic
1102512202 12:113423065-113423087 CCCATCAGGCACCTGAGGTCTGG - Intronic
1102571233 12:113828319-113828341 CTCATCAGTTACCTGTAGGCAGG - Intronic
1103330853 12:120153198-120153220 CCCAGCAGGTACCTGCCATCTGG - Exonic
1104673545 12:130697138-130697160 CTCCTGAGGTACCTCCAGTCTGG - Intronic
1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG + Intronic
1113551905 13:111199154-111199176 CCCATCAGCTTCCTACAGGCAGG - Intronic
1115217215 14:31025892-31025914 CCAACGAGGTACCTGCAGTTCGG + Exonic
1119444581 14:74652679-74652701 CCCATCAGGGGCCTGGAGCCTGG + Intergenic
1122206749 14:100151473-100151495 TCCAGCAGGTGCCTGCAGGCAGG - Intronic
1122745030 14:103892419-103892441 CCCAGCAGGAAGCTGCAGTGAGG - Intergenic
1122958947 14:105085805-105085827 CCCATCAGGTTTATGCAGTGAGG + Intergenic
1123075233 14:105664639-105664661 CCGATCATGTTCCTGTAGTCGGG + Intergenic
1123089881 14:105737775-105737797 CCGATCATGTTCCTGTAGTCGGG + Intergenic
1127274087 15:57427011-57427033 CCCCTCAGGTACTTGCAGAACGG - Intronic
1128518178 15:68356958-68356980 CCTCTCAGGTAGTTGCAGTCTGG - Intronic
1129691748 15:77717794-77717816 CCCATTGGATACCTACAGTCTGG + Intronic
1130158184 15:81371484-81371506 ATCATCAGGCACCTGCAGTGTGG - Intronic
1132557802 16:580087-580109 CCCATCCCGGAGCTGCAGTCGGG - Intronic
1132950707 16:2560744-2560766 CCCACCAGGAATCTCCAGTCTGG + Intronic
1132963643 16:2639426-2639448 CCCACCAGGAATCTCCAGTCTGG - Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1136333336 16:29595656-29595678 CCAATCAAGGACCTGCAGTGTGG + Intergenic
1141467919 16:84219278-84219300 CCCCTCAGTTAGCTGCAGGCAGG - Exonic
1143107780 17:4538089-4538111 CCCATCTGGGACCTCCAGGCTGG - Exonic
1143145383 17:4771999-4772021 CCCATTAGGTACCAGCAGGAGGG - Exonic
1144578915 17:16447017-16447039 CCCTGCAGGTCCCTGCAGGCTGG - Intronic
1144585761 17:16486654-16486676 CCCATCCGGCAGGTGCAGTCTGG - Intronic
1150705106 17:67479329-67479351 CCCATGAGGAACAGGCAGTCAGG + Intronic
1151674760 17:75591720-75591742 CCCATGAGGTACCTCCAGCCTGG - Intergenic
1152032957 17:77855037-77855059 CCTAGCAGGTTCCTGCTGTCAGG - Intergenic
1160805391 19:990287-990309 CCCATCACGGACCTGCACTGCGG + Exonic
1162722189 19:12669162-12669184 CCCAGCAGGTTCATGTAGTCCGG + Exonic
1163460305 19:17433448-17433470 CATATCAGGTGCCTGGAGTCTGG + Intronic
1164478919 19:28596725-28596747 CCCAGCAGGTGCCTGCTCTCTGG - Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166545886 19:43634839-43634861 TCCATCAGGTTCCAGGAGTCTGG + Intronic
1168254789 19:55159438-55159460 TCCACCAGGTACCTGCAGATGGG + Exonic
926500100 2:13642996-13643018 TTCATCAGGAACCAGCAGTCTGG + Intergenic
927494612 2:23544100-23544122 CCCATCAGATAGGGGCAGTCTGG + Intronic
928999612 2:37333144-37333166 CCCATCAATTCACTGCAGTCTGG - Intergenic
929699437 2:44149156-44149178 TGCATCAGGGAACTGCAGTCAGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
937077432 2:119117442-119117464 TCCCTCAGGCACCTGCAGGCTGG + Intergenic
937412609 2:121689615-121689637 CCCATAAGGTTCCTGTGGTCTGG + Intergenic
938378554 2:130824004-130824026 CCCAGCATGTTCCTGTAGTCGGG + Intergenic
939600668 2:144186076-144186098 TCCATCAGGTAACTGAAGCCAGG + Intronic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943179969 2:184529207-184529229 CCCAAGAGGTACCTCCAGTGGGG - Intergenic
944364657 2:198903743-198903765 CCCATTTGGTACCTACAGACTGG + Intergenic
946865172 2:224036115-224036137 CCAATCAGTTACCTGCAGTCTGG - Intronic
948458027 2:238116304-238116326 CCCATCAGGTACAAGGAGACAGG + Intronic
1172011006 20:31845556-31845578 CCCAGCAGGTCCCAGCAGCCTGG - Exonic
1172621468 20:36320664-36320686 CACACCTGGTACCTGGAGTCTGG + Intronic
1175539171 20:59737388-59737410 TCCATCAAGGGCCTGCAGTCAGG + Intronic
1176161557 20:63651356-63651378 CCCAACAGGAGCCTGCAGTCAGG - Intronic
1180155787 21:45976985-45977007 CCCATCAGGACCCTGCGTTCAGG - Intergenic
1181463753 22:23099861-23099883 CCCCTCAGGTGCCTCCAGTGGGG - Intronic
1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG + Intronic
1182475073 22:30572825-30572847 CCCTTCAGGAGCCTGCAGCCGGG + Intronic
1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG + Intergenic
949476036 3:4446599-4446621 CCCATGAGGCACCTGATGTCTGG - Intronic
949571404 3:5297044-5297066 CCCATTGGGTACCTGTTGTCTGG - Intergenic
952900647 3:38109657-38109679 CCCATCTGATTCCTGCAGGCAGG + Intronic
955446187 3:59012705-59012727 CCCTTCAAGTGCCTGTAGTCTGG - Intronic
956851243 3:73230226-73230248 CCCACCAGGTTCCGGCAGACAGG - Intergenic
962808991 3:138946130-138946152 CCCCCCAAGTACCTGCAGTCTGG - Exonic
968648622 4:1751737-1751759 CCCGGCAGGTCCCTGCTGTCTGG - Intergenic
972092235 4:35301620-35301642 CCCTTCAGGGGCCTGCTGTCAGG - Intergenic
972137154 4:35906515-35906537 CCCATCTGGGACCTCCAGTCAGG - Intergenic
974203355 4:58669096-58669118 TTCATCTGGTACCAGCAGTCTGG - Intergenic
976408677 4:84687900-84687922 CCCATCAGGTGTCTGCACTAAGG - Intronic
976649853 4:87422803-87422825 CCCATCAGATACCCGCGGCCGGG + Exonic
981004163 4:139858016-139858038 TCCATCAGGCAACTGCAGACTGG + Intronic
983600597 4:169522773-169522795 CTCATCAGGTCCCTGGTGTCAGG + Intronic
990960182 5:61385847-61385869 CCAATCAGGCACCAACAGTCTGG - Intronic
999661140 5:153863876-153863898 CCCAACAGGGTGCTGCAGTCAGG - Intergenic
1000340360 5:160272363-160272385 CCTGCCAGGTACCTGCAGTGGGG - Intronic
1001193996 5:169655186-169655208 CTGATCTGTTACCTGCAGTCAGG + Intronic
1003903071 6:10673191-10673213 CCCACCAGGGGCATGCAGTCAGG - Intronic
1009480384 6:64150312-64150334 CCCATCTGCTACCTGCATTAAGG - Intronic
1010902353 6:81442721-81442743 TCCAGGTGGTACCTGCAGTCAGG + Intergenic
1013705768 6:112832309-112832331 CCCAACAGGTACCTGAAGAAAGG + Intergenic
1019095755 6:169577656-169577678 CCCACCACGGAACTGCAGTCGGG + Intronic
1019506582 7:1394484-1394506 CCCATCATGCAGCTGCAGCCAGG - Intergenic
1020430649 7:8113387-8113409 CCCACCAGGCACCTGCTGTGGGG + Exonic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1023942819 7:44780998-44781020 CCCATGAGGTCCCCGCTGTCTGG - Intergenic
1026061360 7:67029595-67029617 TCCAGCAGGTATCTGAAGTCAGG - Intronic
1026716990 7:72797818-72797840 TCCAGCAGGTATCTGAAGTCAGG + Intronic
1030832898 7:114248911-114248933 TCCATCATGTACCAGCTGTCTGG - Intronic
1031301212 7:120063486-120063508 TCAATGAGGTACCTGCACTCTGG + Intergenic
1034752600 7:153585111-153585133 TCCAGCAGGTACCGGCAGTGTGG + Intergenic
1039251982 8:35676142-35676164 CTGATCAGGAACCTGCTGTCTGG + Intronic
1039974316 8:42348022-42348044 CCCATCAAATACATGCAGTGTGG + Intronic
1047205115 8:122796955-122796977 CCCATCAGGCAGATGCAGGCCGG + Intronic
1048193073 8:132308067-132308089 CCCAGCAGGGAGCTGCAGGCAGG + Intronic
1050704990 9:8386669-8386691 CCCACCACGTTCCTGAAGTCTGG + Intronic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1057122107 9:92585940-92585962 CCCTTCAGGAACCAGCAGACAGG - Intronic
1061985427 9:134127585-134127607 CCCACCTGGTACCTGCCCTCAGG - Intergenic
1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG + Intergenic
1185468939 X:371193-371215 CCCAGCATGTACCTGGAGTGGGG - Intronic
1189485719 X:41430143-41430165 CCCATCAGGTGCCAGGAGACAGG - Intergenic
1202073230 Y:21014278-21014300 CCCAAGAGGTACCTTCAGTGGGG - Intergenic
1202077930 Y:21056132-21056154 CCCAAGAGGTACCTTCAGTGGGG - Intergenic