ID: 1112324239

View in Genome Browser
Species Human (GRCh38)
Location 13:98432818-98432840
Sequence GGACCCACTGGAGGGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 8, 3: 63, 4: 573}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112324228_1112324239 28 Left 1112324228 13:98432767-98432789 CCTGTACTGGGCGTGTGAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG 0: 1
1: 0
2: 8
3: 63
4: 573
1112324233_1112324239 -10 Left 1112324233 13:98432805-98432827 CCCTGACCTCACAGGACCCACTG 0: 1
1: 0
2: 0
3: 35
4: 456
Right 1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG 0: 1
1: 0
2: 8
3: 63
4: 573
1112324232_1112324239 -9 Left 1112324232 13:98432804-98432826 CCCCTGACCTCACAGGACCCACT 0: 1
1: 0
2: 0
3: 56
4: 657
Right 1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG 0: 1
1: 0
2: 8
3: 63
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112324239 Original CRISPR GGACCCACTGGAGGGTCTGC AGG Intronic
900148527 1:1168427-1168449 GGGCTCCGTGGAGGGTCTGCTGG + Intergenic
900362773 1:2297918-2297940 GGACGCACGGGAGGGGTTGCAGG + Intronic
900381781 1:2387776-2387798 GGACCCTCTGGTCGGTTTGCAGG + Intronic
900550960 1:3255333-3255355 GACCCCACTGTGGGGTCTGCAGG - Intronic
901445969 1:9308326-9308348 GGACCTACTGCTGGGTATGCAGG - Intronic
901627345 1:10631613-10631635 CCACCCACTGGAGGGTCACCGGG + Intergenic
901638288 1:10680374-10680396 GGACCCACAGGTCTGTCTGCAGG + Intronic
901681058 1:10913089-10913111 TGACCGACTGGAGGGTGTGGAGG - Intergenic
901988105 1:13091877-13091899 GGGCCCTGTGCAGGGTCTGCTGG + Intergenic
901988247 1:13092474-13092496 GGGCCCTGTGCAGGGTCTGCTGG + Intergenic
901993565 1:13134293-13134315 GGGCCCTGTGCAGGGTCTGCTGG - Intergenic
901993707 1:13134890-13134912 GGGCCCTGTGCAGGGTCTGCTGG - Intergenic
902322243 1:15676076-15676098 GAACCCACTGAAGGGTTTGGAGG - Intergenic
902554834 1:17240779-17240801 GGTCCTGCTGGGGGGTCTGCGGG + Intronic
902877371 1:19349074-19349096 GGCAGCACTGGAGCGTCTGCTGG + Intronic
903216680 1:21847346-21847368 AGACTCACCGGAGGGGCTGCCGG + Exonic
904253922 1:29242703-29242725 GGACTCACTGAAGGTGCTGCAGG - Intronic
904491458 1:30862484-30862506 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
904722252 1:32519082-32519104 TGTCCCACTGGAAGGTCTTCAGG + Intronic
905360641 1:37417482-37417504 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
905829255 1:41051514-41051536 TGTCCCACTGGAAGGTCTTCAGG - Intronic
906547489 1:46630827-46630849 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
907117511 1:51982102-51982124 TGTCCCACTGGAAGGTCTTCAGG - Intronic
907215164 1:52857203-52857225 GGAGACACTGGAGGTTTTGCTGG - Exonic
907222652 1:52918477-52918499 TGTCCCACTGGAAGGTCTTCAGG - Intronic
908617260 1:65936156-65936178 TGCCCCACTGGAGGGTCTTCAGG + Intronic
909400549 1:75224478-75224500 TGTCCCACTGGAAGGTCTTCAGG - Intronic
909418648 1:75436972-75436994 TGACCCACTGGAAGGTCTTCAGG + Intronic
909886913 1:80953136-80953158 TGTCCCACTGGAAGGTCTTCCGG + Intergenic
910268837 1:85370466-85370488 GAAGTCACTGGAGAGTCTGCAGG + Intronic
910595564 1:88976714-88976736 TGTCCCACTGGAAGGTCTTCAGG - Intronic
910667124 1:89737909-89737931 TGTCCCACTGGAAGGTCTTCAGG + Intronic
910900969 1:92120329-92120351 TGTCCCACTGGAAGGTCTTCGGG + Intronic
910947032 1:92604458-92604480 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911061809 1:93754950-93754972 TGTCCCACTGGAAGGTCTTCAGG - Intronic
911135437 1:94434228-94434250 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911211228 1:95139976-95139998 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911476111 1:98374749-98374771 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
911539290 1:99139148-99139170 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
911544123 1:99196053-99196075 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
911545304 1:99209109-99209131 GGTCCCACTAGAAGGTCTTCAGG + Intergenic
911661079 1:100501762-100501784 TGTCCCACTGGAAGGTCTTCAGG - Intronic
912692093 1:111812222-111812244 GGCTCCACTGGTGGGTCTGGAGG + Intronic
914380136 1:147108297-147108319 GGTCCCCCTGGAGGGACTGAAGG + Intergenic
914778019 1:150756214-150756236 TGTCCCACTGGAAGGTCTTCAGG + Intronic
914937906 1:151996296-151996318 GGTCCCACTGAAAGGTCTCCAGG - Intergenic
915029372 1:152863452-152863474 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
915042849 1:152983218-152983240 GGACCCCATGGATGGGCTGCAGG + Intergenic
915115820 1:153598840-153598862 GCAGCCACTGGAGGGTCAGTGGG - Intergenic
915936923 1:160095115-160095137 GGAACCACTCGAAGTTCTGCTGG + Exonic
916410161 1:164539268-164539290 TGTCCCACTGGAAGGTCTCCAGG - Intergenic
917131625 1:171749109-171749131 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
917137568 1:171802425-171802447 GGTCCCTCTGGAGGCTCTGAGGG - Intronic
918134173 1:181656280-181656302 TGTCCCACTGGAAGGTCTTCAGG - Intronic
919295467 1:195693870-195693892 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
919405662 1:197179633-197179655 TGTCCCACTGGAAGGTCTTCAGG - Intronic
920717170 1:208350928-208350950 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
921047118 1:211485413-211485435 GGACCCACTGAAGAGCCTTCTGG - Intronic
921187469 1:212682960-212682982 GAATCCACAGGAGGGTGTGCTGG - Intergenic
921770466 1:219032333-219032355 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
922193681 1:223341422-223341444 GGACCCTCTCCAGGCTCTGCTGG - Intronic
922790067 1:228306391-228306413 GGAGCCGCTGCAGAGTCTGCAGG + Exonic
923128164 1:231050569-231050591 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
923312642 1:232750059-232750081 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
923405857 1:233659290-233659312 TGTCCCACTGGAAGGTCTTCAGG + Intronic
923417906 1:233782740-233782762 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1062794814 10:336749-336771 TGTCCCACTGGAGGGCCTTCAGG - Intronic
1064126631 10:12667120-12667142 GGGCCCACTGAAGTGTCTTCAGG - Intronic
1065350122 10:24787910-24787932 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1065604404 10:27402092-27402114 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1065631117 10:27682035-27682057 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1067250807 10:44585573-44585595 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1068441333 10:57058471-57058493 TGTCCCACTGGAAGGTCTTCTGG + Intergenic
1068546419 10:58351528-58351550 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1068672746 10:59740465-59740487 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1068795314 10:61072912-61072934 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1069051098 10:63795575-63795597 CGTCCCACTGGAAGGTCTCCAGG + Intergenic
1070941782 10:80354759-80354781 GGACCCTCTGGCTGGTGTGCAGG - Intronic
1071875249 10:89837397-89837419 GGACCAAGTGGAGAGGCTGCTGG + Intergenic
1072802392 10:98401783-98401805 TGCCCCACTGCAGGGTCTTCAGG + Intronic
1072897362 10:99378338-99378360 GAACCCACTGGGTGTTCTGCTGG - Intronic
1073084170 10:100877725-100877747 GGACCCATTTGTGGGACTGCAGG - Intergenic
1073183720 10:101602499-101602521 AGGCCCACTGCAGGGGCTGCTGG - Intronic
1073274096 10:102293559-102293581 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1074342752 10:112650341-112650363 TGTCCCACTGGAAGATCTGCAGG + Intronic
1074626178 10:115189438-115189460 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1074728729 10:116344957-116344979 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1075163562 10:120045848-120045870 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1075445366 10:122509337-122509359 GGAGCGACTGGAGGGGCAGCTGG + Intronic
1075498110 10:122945522-122945544 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1075770052 10:124926512-124926534 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1075943456 10:126411023-126411045 GGGCTCAGTGGAGGGCCTGCTGG - Intergenic
1076309383 10:129493297-129493319 GGCCCCAGTGGAGCGTCTGGAGG + Intronic
1076356561 10:129857740-129857762 GGACCCACTGCCGGGTGGGCAGG + Intronic
1077440622 11:2567058-2567080 GGGCCCACGGGAGGCTCTGGGGG + Intronic
1077496647 11:2889943-2889965 GGGCCCACTAGAGAGTCTCCAGG + Intronic
1077751986 11:4981934-4981956 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1078343459 11:10520458-10520480 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1079010773 11:16826394-16826416 GGACCCACTGGAGGGCAAGCGGG - Exonic
1079680930 11:23297406-23297428 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1080282461 11:30573554-30573576 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1081004230 11:37714154-37714176 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1083761947 11:64823628-64823650 GGGGCCACTGGAGGGTCTCCGGG - Exonic
1084293216 11:68190527-68190549 TGTCCCACTGGAGCGTCTTCAGG - Intronic
1084753186 11:71217610-71217632 CGTCCCACTGGAAGGTCTTCAGG - Intronic
1085540705 11:77266630-77266652 TGTCCCACTGCAGTGTCTGCAGG - Intronic
1087015930 11:93554749-93554771 GCTCCCACTTGAGGGTCTGGGGG + Intergenic
1087258465 11:95983153-95983175 TGACCCACTGGAAGGTGTTCAGG - Intronic
1088086859 11:105991628-105991650 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1088096781 11:106109627-106109649 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1088266164 11:107989860-107989882 GGTCCCACAGGAAGGTCTTCAGG + Intergenic
1088462653 11:110098124-110098146 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1088744045 11:112790120-112790142 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1089401996 11:118169634-118169656 GGACCAGCTGATGGGTCTGCAGG + Intronic
1089688255 11:120170264-120170286 GGACCCTCTGGAGGGTCGGGTGG + Exonic
1090205710 11:124882951-124882973 GGAGGCACTGGAGGGTAGGCAGG - Intergenic
1090529323 11:127574357-127574379 GGACTTACTGGAGAGTCTCCAGG - Intergenic
1090703283 11:129315084-129315106 GGACCCACTGATGGGTGTCCTGG - Intergenic
1090954391 11:131501525-131501547 GGAGCTACTGGAGGGTCTTCAGG + Intronic
1091235293 11:134018133-134018155 TGAGACACTGGCGGGTCTGCGGG + Intergenic
1091361232 11:134979897-134979919 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1091812750 12:3413520-3413542 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1092239180 12:6827041-6827063 GGACCCAAGGGAGAGTCGGCGGG - Exonic
1092546483 12:9456368-9456390 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1094446606 12:30537816-30537838 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1094506457 12:31065706-31065728 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1094828664 12:34289901-34289923 GGACCCCATGCAGGGACTGCTGG + Intergenic
1094828998 12:34291302-34291324 GGACCCTGTGCAGGGGCTGCTGG + Intergenic
1094829891 12:34295298-34295320 AGACCCCATGCAGGGTCTGCTGG + Intergenic
1094830027 12:34295883-34295905 GGACCCAATGCAGGGCTTGCTGG - Intergenic
1094830204 12:34296677-34296699 GGACCCCATGCAGGGGCTGCTGG - Intergenic
1094831313 12:34301563-34301585 GGACCCCCTGTAGGTGCTGCTGG - Intergenic
1094836751 12:34325692-34325714 GGACCCGATGCAGGGGCTGCTGG + Intergenic
1094837676 12:34329760-34329782 GGCCCACCTGCAGGGTCTGCTGG + Intergenic
1095098450 12:38160022-38160044 GGGCCCACTGCAGAGGCTGCTGG - Intergenic
1095223998 12:39656685-39656707 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1095436457 12:42193850-42193872 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1096188502 12:49599461-49599483 GGACCTACCGGAGGCTCTGGAGG + Exonic
1097143581 12:56924168-56924190 GGACCACCTGGAGGGTGTGGCGG - Intronic
1097630883 12:62060692-62060714 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1098159570 12:67636392-67636414 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1098800273 12:74948792-74948814 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1100152370 12:91754988-91755010 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1100320202 12:93484023-93484045 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1100999892 12:100346864-100346886 GGACCCACTGGAGAGGTTTCAGG + Intergenic
1101050794 12:100861950-100861972 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1101110752 12:101483344-101483366 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1101555372 12:105803788-105803810 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1101563090 12:105878730-105878752 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1101673011 12:106894246-106894268 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1102839764 12:116106244-116106266 GGACCAACTGGATGGACTTCTGG + Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1104856508 12:131904785-131904807 GCACTCACTGGAGGGGCTGTGGG + Intronic
1105683774 13:22756626-22756648 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1106406121 13:29475528-29475550 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1107268812 13:38589989-38590011 TGTTCCACTGGAAGGTCTGCAGG - Intergenic
1107321925 13:39199009-39199031 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1107454720 13:40544428-40544450 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1108384861 13:49889868-49889890 TGTCCCACTGGAGGGTCTTCAGG - Intergenic
1108387072 13:49908881-49908903 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1108453721 13:50592234-50592256 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1108531041 13:51327440-51327462 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
1108567511 13:51715483-51715505 CGTCCCACTGGAAGGTCTTCGGG + Intronic
1109104739 13:58236815-58236837 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1109111869 13:58331085-58331107 GAACCCTCAGGAGGGTCTACTGG - Intergenic
1109126784 13:58527891-58527913 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1109454178 13:62561899-62561921 TGTCCCTCTGGAGGGTCTTCAGG - Intergenic
1109505941 13:63303662-63303684 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1109990081 13:70042838-70042860 TGTCCCACTGGAGAGTCTTCAGG - Intronic
1110850829 13:80242462-80242484 TGATCCACTGGAGGATCTTCAGG - Intergenic
1111509315 13:89240558-89240580 TGCCCCACTGGAAGGTCTTCAGG + Intergenic
1111787048 13:92801639-92801661 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1112253940 13:97810796-97810818 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG + Intronic
1112563352 13:100532676-100532698 GGCCCCAGTGGAGGCTCTGTGGG - Intronic
1113030528 13:105989363-105989385 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1113125482 13:106973870-106973892 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1113450095 13:110402950-110402972 GGACCCACTGGAGCCACAGCTGG + Intronic
1113455192 13:110443761-110443783 GGACCCAGTGGAGGCTCCGCCGG - Intronic
1113694443 13:112333911-112333933 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1113782880 13:112986673-112986695 AGCCCCATCGGAGGGTCTGCTGG + Intronic
1114382134 14:22218117-22218139 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1114559088 14:23578100-23578122 GGGCCCAGGGGAGGCTCTGCAGG + Intronic
1114951350 14:27758176-27758198 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1115404961 14:33004942-33004964 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1116425919 14:44791118-44791140 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1116700899 14:48240399-48240421 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1117732551 14:58737951-58737973 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1117873796 14:60228871-60228893 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1119523928 14:75307401-75307423 GCGCCCACTGGAGGGTCCCCTGG - Intergenic
1120210448 14:81628799-81628821 GGAGCCACTGGGGGCTCTGCTGG - Intergenic
1120712979 14:87812153-87812175 GGTCCCACTGGAAGGTCTTCAGG + Intergenic
1121048204 14:90803200-90803222 GGAACCACTGGAGGGTTTAGAGG - Intronic
1121433756 14:93905525-93905547 GGGCCCACAGAAGGGGCTGCTGG + Intergenic
1122267873 14:100555085-100555107 GGGCCAACTGTAGGTTCTGCTGG - Intronic
1122362085 14:101173570-101173592 GGTCTCTCTGGAGTGTCTGCTGG - Intergenic
1122405907 14:101500905-101500927 GGACACAGGGGAGGGACTGCAGG + Intergenic
1122609212 14:102969715-102969737 GGGCCCACTGGTGGGGCTGGAGG - Intronic
1122691408 14:103533613-103533635 GGCCCCAGGGGAGGCTCTGCCGG - Intronic
1122967376 14:105137709-105137731 GGAGCCACGGGAGGGCTTGCTGG - Intergenic
1122985232 14:105208797-105208819 GGACCAGCTGGAGGGGCTCCCGG - Intergenic
1124139261 15:27063233-27063255 GGACACACAGGAGTGTCTTCGGG + Intronic
1124506917 15:30285405-30285427 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1124736640 15:32253256-32253278 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1125436768 15:39654036-39654058 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1125519850 15:40341863-40341885 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1125990679 15:44104068-44104090 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1126529463 15:49696923-49696945 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1126880903 15:53096130-53096152 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1127897996 15:63319597-63319619 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1128310297 15:66627104-66627126 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1129961092 15:79685285-79685307 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1130156253 15:81352705-81352727 TGTCCCACTGGAAGGTCTTCGGG - Intronic
1131252084 15:90837620-90837642 GGAGCCAGTTGAGGGTCTGTGGG + Intergenic
1131412535 15:92222010-92222032 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1131553299 15:93376135-93376157 GTTCCCACTGGAGGCTCTACAGG - Intergenic
1132033151 15:98455420-98455442 TGTCCCACTGGAAGGTCTCCAGG - Intronic
1132290934 15:100703515-100703537 GGGCCCAGTGGGGAGTCTGCTGG + Intergenic
1132458860 16:39441-39463 ACACCCACGGGAGGGTCTTCAGG + Intergenic
1132463866 16:68651-68673 GGACCAGCTGGGGGGGCTGCGGG + Intronic
1133016556 16:2944947-2944969 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1133086002 16:3364208-3364230 GGACCCACTGAAAGGACTGGAGG - Intergenic
1134789435 16:16975635-16975657 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1135237761 16:20774716-20774738 GGACCCACTGGAGCCACTGCTGG - Intronic
1137271902 16:46907737-46907759 GGAGCCACTGAAGGGTTTGAAGG + Intronic
1137889306 16:52141683-52141705 GGACACACTGGAGGGTCATTGGG + Intergenic
1139002398 16:62528499-62528521 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1139430185 16:66907010-66907032 ACCCCCACTGGAGGCTCTGCTGG - Intergenic
1139729795 16:68933495-68933517 AGACCCACTGAAGGTTCAGCGGG + Intronic
1140716581 16:77731750-77731772 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1141072373 16:80969442-80969464 GGGCCCACAGGAAGGTCTGAAGG + Exonic
1141148054 16:81545781-81545803 GGGCCCACGGGAGGGCCGGCAGG - Intronic
1142181670 16:88674225-88674247 GGACCCACACCAGGGTGTGCAGG - Intergenic
1142246626 16:88973171-88973193 GGAGGCACTGGAGAGGCTGCAGG - Intronic
1142324082 16:89402858-89402880 GGAGAGCCTGGAGGGTCTGCAGG - Intronic
1142484709 17:239106-239128 GGACCCACCAAGGGGTCTGCAGG + Intronic
1143327449 17:6108809-6108831 GGACCCACTTAAGAGACTGCTGG + Intronic
1143339380 17:6197984-6198006 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1143615728 17:8048026-8048048 TGTCCCACTGGAGGGTCAGTGGG - Intronic
1144370108 17:14582210-14582232 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1145085524 17:19935727-19935749 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1145903803 17:28505724-28505746 GCACCCACTGGAGCATGTGCTGG - Intronic
1147513664 17:41095889-41095911 TAACCCTCTGGTGGGTCTGCTGG - Intronic
1147877423 17:43631618-43631640 GGGGCCATTGGAGGCTCTGCAGG + Intergenic
1148223197 17:45879592-45879614 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1148824579 17:50383011-50383033 GGACCCACTGGAGGATCTCATGG + Exonic
1148849356 17:50547334-50547356 GGGCCCAGTGGAGGGTCTTCCGG + Intronic
1148911891 17:50947275-50947297 GGACCTCCTGGAGGGTCTGCAGG + Intergenic
1150607157 17:66703367-66703389 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1150683099 17:67298911-67298933 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1150867833 17:68872671-68872693 TGTCCCACTGGAAGGTCTTCGGG - Intronic
1151386102 17:73756440-73756462 GCACCCTATTGAGGGTCTGCAGG - Intergenic
1151575083 17:74949143-74949165 GGTGGCACTGGAGGGGCTGCAGG + Intronic
1151718410 17:75843025-75843047 TGACCCGCTGCAGTGTCTGCTGG + Exonic
1152392920 17:80013388-80013410 GCACCCGCCGGAGGGGCTGCAGG - Exonic
1153198635 18:2627244-2627266 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1153470124 18:5434936-5434958 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1153692866 18:7610954-7610976 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1153955704 18:10093995-10094017 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1154337093 18:13474584-13474606 GGACCCAGAGGATGGTCTGCAGG + Intronic
1154494062 18:14942995-14943017 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1155223108 18:23703220-23703242 GGAACCACTGGAGTGCTTGCTGG - Intronic
1155632920 18:27915966-27915988 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1156293820 18:35772778-35772800 AGCACCACTAGAGGGTCTGCTGG + Intergenic
1156537214 18:37875577-37875599 GGAGAGACTGGAGGGTGTGCAGG - Intergenic
1156778876 18:40826143-40826165 GGACACACACGAGGGCCTGCTGG + Intergenic
1156974526 18:43202762-43202784 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1157129110 18:44986737-44986759 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1159705233 18:71677948-71677970 CGTCCCAGTGGAGGGTCTTCCGG - Intergenic
1160918739 19:1510162-1510184 GCACCCACTGGTAGGTCTTCTGG + Exonic
1161020041 19:2005175-2005197 GCACTCACTGGCTGGTCTGCGGG + Intronic
1161333605 19:3699722-3699744 GGACACACTGGTGGGGCTGCGGG - Intronic
1161373591 19:3927561-3927583 GGACCCCCTGGAGTTTCTGGTGG - Exonic
1161801042 19:6416854-6416876 GGACCCCCTGGAGGACCTGGGGG + Exonic
1162490282 19:10987451-10987473 GGCCCCAGTGGAGGGTGTGAAGG + Intronic
1162967077 19:14161110-14161132 GGACTCCCTGCAGGTTCTGCAGG + Intronic
1163081645 19:14948154-14948176 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1163207345 19:15813377-15813399 GAACCCACTGGATGTTCTGCTGG - Intergenic
1163234018 19:16020674-16020696 GGACCCAGTGGGTGGTCAGCAGG + Intergenic
1163316190 19:16542214-16542236 GGACCCACGGGAGAGGCCGCAGG + Intronic
1163403665 19:17109635-17109657 GGTCCCTCTGGAGGCTCTGAGGG + Intronic
1163578614 19:18124761-18124783 GGACCCCCTGGAGGGTAAGCCGG + Exonic
1163969297 19:20776716-20776738 GGGACCACCGGAGGGTCTTCAGG + Intronic
1164005268 19:21142475-21142497 GGGACCACGGGAGGGTCTTCAGG + Intronic
1164857876 19:31539001-31539023 GGACCAACTGGGGGCTGTGCTGG - Intergenic
1164947000 19:32304136-32304158 GGGTCAACTGGAGGATCTGCAGG + Intergenic
1165586414 19:36920088-36920110 GGCCCCACTGGAAGATCTTCAGG - Intronic
1165699156 19:37924299-37924321 TGTCCCACTGGAAGGTCTTCGGG + Intronic
1166658417 19:44628919-44628941 GGAGCCACGTGAGGGTCTGAAGG + Intronic
1166853975 19:45773259-45773281 GTTCCCACAGGAGGGACTGCTGG - Intronic
1166991624 19:46696271-46696293 GGAGCCACTGGGGGGTTTGACGG + Intronic
1167660696 19:50794468-50794490 GGGCCCCCTGGAGGGCCAGCAGG - Exonic
1168514317 19:56998271-56998293 GGACTCAGTGCAGGGCCTGCGGG + Intergenic
925669675 2:6297581-6297603 GGAGGCCGTGGAGGGTCTGCTGG + Intergenic
925915836 2:8605114-8605136 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
926147980 2:10408397-10408419 TTACCCACTGGAGGGGCTCCAGG - Intronic
928221977 2:29411205-29411227 TGTCCCACTGGAAGGTCTTCAGG + Intronic
929514322 2:42592706-42592728 TGTCCCACTGGAAGGTCTTCAGG + Intronic
930182816 2:48381804-48381826 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
931179519 2:59885519-59885541 GGGCCCACTGGAGGCTCGGTCGG - Intergenic
931423256 2:62147432-62147454 TGTCCCACTGGACGGTCTCCAGG - Intergenic
932277992 2:70465718-70465740 GCAGCCACGGGCGGGTCTGCTGG + Exonic
932444817 2:71772301-71772323 TGTCCCACTGGAAGGTCTACAGG - Intergenic
932690722 2:73911032-73911054 TGGCCCACTGGAAGGTCTTCAGG + Intronic
933662489 2:84939194-84939216 GGACCCACCAGCAGGTCTGCAGG + Intergenic
934029624 2:88031200-88031222 TGTCCCACTGGGGGGTCTTCAGG - Intronic
934486002 2:94711525-94711547 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
934779432 2:96960391-96960413 GGACCGGCGGGATGGTCTGCAGG + Exonic
934864804 2:97798019-97798041 GGACCAGCTGAAGGGTCTTCAGG + Intronic
935423603 2:102896122-102896144 TGTTCCACTGGAGGGTCTTCAGG - Intergenic
935611917 2:105034818-105034840 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
935644410 2:105322054-105322076 TGTCCCACTGGAAGGTCTTCGGG - Intronic
935674746 2:105584994-105585016 GGGCTGACTGGAGGCTCTGCTGG - Intergenic
935818666 2:106871725-106871747 TGTCCCACTGGAAGGTCTTCAGG + Intronic
935866291 2:107391265-107391287 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
936180221 2:110260636-110260658 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
936289090 2:111205314-111205336 CGTCCCACTGGAGGGTCTTCAGG - Intergenic
936579559 2:113685983-113686005 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
937466173 2:122134988-122135010 GGAGCTGCTGGAGGGCCTGCAGG + Intergenic
938813546 2:134876538-134876560 TGTCCCACTGGAAGGTCTTCGGG + Intronic
939330215 2:140749613-140749635 TGTCCCACTGGAAGGTCTTCAGG + Intronic
940023003 2:149175839-149175861 TGTCCCACTGGAAGGTCTTCAGG + Intronic
940038607 2:149335247-149335269 TGTCCCACTGGAAGGTCTTCAGG - Intronic
940202856 2:151170344-151170366 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
941416722 2:165230501-165230523 GGACCCAGTGGAGGGTTCTCAGG - Intergenic
942049161 2:172122614-172122636 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
942264819 2:174212805-174212827 TGTCCCACTGGAAGGTCTTCAGG + Intronic
942493497 2:176513708-176513730 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
942765761 2:179454615-179454637 TAACCCACTGGAAGGTCTCCAGG - Intronic
943667741 2:190628026-190628048 GGAGCAGCTGGAGGGACTGCGGG - Intergenic
944208460 2:197182321-197182343 GGAGCCACTGAAGGGTCAGGAGG - Intronic
944329567 2:198449573-198449595 TGTCCCACTGGAAGGTCTACAGG - Intronic
947410008 2:229827593-229827615 TGTCCCACTGGAAGGTCTTCAGG + Intronic
947546602 2:231014967-231014989 GGACTCCCTGTAGGGTTTGCTGG - Intronic
947550785 2:231044779-231044801 TGTCCCACTGGAAGGTCTTCAGG + Intronic
948259329 2:236591189-236591211 GGTTCTTCTGGAGGGTCTGCGGG + Intergenic
948724638 2:239926723-239926745 TGTCCCACTGGAAGGTCTTCAGG - Intronic
948874511 2:240819718-240819740 GGAGCCACCGGCGGGGCTGCGGG - Intronic
1168827402 20:823068-823090 GGCCCCTGTGGAGGGTCTGAGGG + Intergenic
1169057884 20:2638601-2638623 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1169685258 20:8264256-8264278 TGTCCCACTGGAAGGTCTGCAGG + Intronic
1170689106 20:18596105-18596127 GGACACACTGGAGGGTAAACTGG - Exonic
1171437527 20:25134834-25134856 GGACCTTCTGGGGTGTCTGCTGG - Intergenic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1173727571 20:45308136-45308158 GGAGGCACTGAGGGGTCTGCAGG - Exonic
1174491126 20:50896683-50896705 TGTCCCACTGGAGGGTCTTCAGG + Intronic
1175301288 20:57944811-57944833 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1175303867 20:57962514-57962536 GGACCCCCGGGAGAGACTGCAGG + Intergenic
1175940413 20:62535184-62535206 GGACCCCCTTGAGGGCCTGCAGG + Intergenic
1176238472 20:64065072-64065094 GGACCCCCAGGAGGCTCTGCTGG - Intronic
1176675033 21:9769879-9769901 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1177591891 21:23181899-23181921 GTACCCATAGGAGTGTCTGCAGG + Intergenic
1177664381 21:24134832-24134854 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1178458240 21:32776093-32776115 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1179101619 21:38359597-38359619 GAAACCATTGGAGGGTCTGAGGG + Intergenic
1179115220 21:38485119-38485141 TGTGCCACTGGAAGGTCTGCAGG - Intronic
1179410325 21:41157475-41157497 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1179580688 21:42341968-42341990 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
1179805694 21:43835668-43835690 GGAGCCCCTGGAGGATCTGCTGG + Intergenic
1180061613 21:45388221-45388243 GCCTCCACTGGAGGGACTGCTGG + Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1181089008 22:20459303-20459325 GGCCACACTGCAGGGGCTGCAGG - Intronic
1183519863 22:38290625-38290647 AGACCCACTTCCGGGTCTGCAGG + Intergenic
1184657412 22:45948697-45948719 GGACCCACACGAGGGCCTACTGG + Intronic
1184684397 22:46089606-46089628 GGCCCACCTGGAGGGGCTGCTGG + Intronic
1184824389 22:46937704-46937726 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1185344621 22:50305876-50305898 GGGCCCACTGCAGGCTCAGCAGG + Intronic
949132220 3:517401-517423 TGCCCCACTGGAAGGTCTCCCGG - Intergenic
950126174 3:10511068-10511090 AGACCCACTGTGGGGTCTGAGGG - Intronic
950245692 3:11415670-11415692 TGACCCACTGGAAGGTCTTCAGG + Intronic
950277892 3:11679239-11679261 TGTCCCACTGGAAGGTCTTCAGG - Intronic
951213652 3:20003295-20003317 TGTCCCACTGGAAGGTCTTCAGG - Intronic
951475157 3:23097217-23097239 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
951999072 3:28764137-28764159 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
953193722 3:40713017-40713039 GGACCCACGGTTGGGTCTGTGGG - Intergenic
953886748 3:46718272-46718294 AGCCCCACTGGAGGGGCTGGAGG - Exonic
954215042 3:49120076-49120098 GAATCCACTGGTGGGTCTGTGGG - Intronic
954975847 3:54693665-54693687 TGTCCCACTGGAAGGTCTTCAGG - Intronic
955138448 3:56244503-56244525 GATCCCACTGGAAGGTCTTCAGG - Intronic
955371715 3:58357377-58357399 TGTCCCACTGGAAGGTCTTCTGG + Intronic
956867045 3:73380081-73380103 GGACCCACTGAAGGATCTGGTGG - Intergenic
957268409 3:77997656-77997678 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
957474705 3:80708408-80708430 TGTCCCACTGGAAGGTCTCCAGG + Intergenic
957552506 3:81725398-81725420 TGTCCCACTGGAAGGTCTTCAGG + Intronic
958168041 3:89902467-89902489 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
958954700 3:100455063-100455085 GGACCTACTGGAGGGTGGGGGGG - Intronic
958982644 3:100741277-100741299 TGTCCCACTGGAAGGTCTTCAGG - Intronic
959386841 3:105719845-105719867 TGTCCCACTGGAAGGTCTTCAGG - Intronic
959569931 3:107872429-107872451 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
959636005 3:108571086-108571108 TGTCCCACTGGAAGGTCTTCAGG + Intronic
960135922 3:114104920-114104942 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
960206646 3:114909151-114909173 TGTCCCACTGGAAGGTCTTCTGG - Intronic
960974571 3:123161782-123161804 TGACCCCCTGGAGGGGCTGGGGG + Intronic
962290975 3:134136098-134136120 GGACCCACTGCAGGCTCCTCAGG - Intronic
962441409 3:135421293-135421315 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
962700193 3:137990539-137990561 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
962828013 3:139116580-139116602 TGTCCCACTGGAAGGTCTTCAGG + Intronic
962885592 3:139623321-139623343 TGTCCCACTAGAAGGTCTGCAGG + Intronic
963043191 3:141083907-141083929 GAACCCTCTGGAGGCCCTGCAGG + Intronic
963134992 3:141894679-141894701 TGCCCCACTGGAAGGTCTTCAGG + Intronic
963493909 3:146035856-146035878 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
964127726 3:153253558-153253580 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
964593986 3:158400524-158400546 TGTCCCACTGGAAGGTCTTCAGG - Intronic
964749868 3:160044340-160044362 TGACACACTGGAAGGTCTCCAGG - Intergenic
964780647 3:160333654-160333676 TGTCCCACTGGAAGGTCTTCAGG + Intronic
965055175 3:163702046-163702068 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
965555510 3:170014193-170014215 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
967127705 3:186439912-186439934 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
967894736 3:194386640-194386662 GGACCCTCTAAAGGCTCTGCAGG + Intergenic
968230205 3:197001349-197001371 GCACCCACTGTAGGGTCTCTGGG + Intronic
968425818 4:522559-522581 GGACCCACTGCAGTGGCAGCAGG + Intronic
968556881 4:1249976-1249998 GGCCCCTCGGGAGAGTCTGCAGG - Intergenic
969057538 4:4411393-4411415 TGTCCCACTGGAAGGTCTTCAGG + Intronic
970424120 4:15930725-15930747 GTACCCACAGGAGGGTCTCCAGG + Intergenic
971001990 4:22333650-22333672 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
972030320 4:34448552-34448574 TCACCCACTGGAAGGTCTTCAGG - Intergenic
972650464 4:41012723-41012745 GGACCCACTAGGGGAACTGCTGG + Intronic
972748624 4:41966615-41966637 GGTTCCACTGGAAGGTCTTCAGG - Intergenic
973113828 4:46429465-46429487 GGAAGCACTGTAGGGTGTGCAGG - Intronic
973286892 4:48428523-48428545 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
973576345 4:52293525-52293547 GGTCTCACTGGAAGGTCTTCAGG + Intergenic
973900856 4:55469506-55469528 TGTCCCATTGGAGGGTCTTCAGG - Intronic
974195128 4:58564373-58564395 TGACCCACTGGAGGGTCTTCAGG + Intergenic
975663782 4:76713445-76713467 TGTCCCTCTGGAAGGTCTGCAGG + Intronic
976418592 4:84810329-84810351 GGACCGACAGGAGGGCCTACAGG + Exonic
978562585 4:110048985-110049007 GGACCCATTGGAGGCTCATCTGG - Exonic
978715471 4:111837528-111837550 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
979504037 4:121474261-121474283 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
980139959 4:128902953-128902975 TGTCCCACTGGAAGGTCTTCAGG + Intronic
980158210 4:129132010-129132032 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
980199074 4:129631033-129631055 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
981943184 4:150308627-150308649 TGTCCCACTGGAAGGTCTTCAGG - Intronic
982926167 4:161339493-161339515 GGGCCTACTGGGAGGTCTGCAGG + Intergenic
984276870 4:177621415-177621437 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
985075903 4:186214281-186214303 GGACCCACTGAAGAGTGAGCAGG - Intronic
985188213 4:187341524-187341546 ATACCCACTGGTGGGACTGCTGG - Intergenic
985385206 4:189438963-189438985 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
985400521 4:189588813-189588835 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
985689137 5:1297444-1297466 GGACCCACTGCAGGGGCAGCTGG - Intergenic
985796414 5:1965415-1965437 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
986098133 5:4580363-4580385 TGACCCACTGGAGGTTGTGGAGG + Intergenic
986258231 5:6119944-6119966 TAACCCACTGGAGGTCCTGCAGG + Intergenic
986417947 5:7547173-7547195 GGACCCACAGCAGAGACTGCTGG + Intronic
986457544 5:7934259-7934281 GTTCCCACTGGAGTGTCTGGTGG + Intergenic
987040023 5:14053594-14053616 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
987110771 5:14684503-14684525 GCATCCACAGGAGGGTCTGCGGG - Intronic
987775054 5:22354593-22354615 GGTCATACTGGAGGATCTGCTGG + Intronic
987802466 5:22716707-22716729 TGTCCCACTGGAAGGTCTTCAGG - Intronic
988102853 5:26704723-26704745 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
988661493 5:33274830-33274852 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
988791641 5:34613788-34613810 TGCCCCACTGGAAGGTCTTCGGG - Intergenic
989175298 5:38518840-38518862 TGTCCCACTGGAAGGTCTTCGGG - Intronic
990091017 5:52049074-52049096 TGTCCCACTGGAAGGTCTTCAGG - Intronic
992671460 5:79065151-79065173 TGTCCCACTGGAAGGTCTTCAGG + Intronic
992943125 5:81782682-81782704 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
993522913 5:88926684-88926706 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
994588802 5:101747835-101747857 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
994638108 5:102367740-102367762 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
995720564 5:115127916-115127938 TGTCCCACTGGAAGGTCTTCTGG - Intronic
995757153 5:115518669-115518691 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
998067006 5:139167370-139167392 AGTCCCACTGGAAGGTCTTCAGG - Intronic
998208515 5:140176028-140176050 GGACTGACTGGACCGTCTGCTGG + Intronic
998258278 5:140606861-140606883 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
998281631 5:140814323-140814345 TGTCCCACTGGAAGGTCTTCTGG + Intronic
999769100 5:154761586-154761608 GGGGCCACTGGAGGTTCAGCAGG + Intronic
1000661839 5:163948166-163948188 GGGGGCAGTGGAGGGTCTGCTGG - Intergenic
1000709281 5:164550657-164550679 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1001816291 5:174672039-174672061 GGACACACAGGAGGGTCTGAGGG - Intergenic
1002385575 5:178863747-178863769 TGCCCCACTGGAAGGTCTTCAGG - Intronic
1002713712 5:181211395-181211417 ATACCCACTGGAGGGCGTGCAGG + Intergenic
1004735843 6:18405689-18405711 GGAGCCACTGCAGGGTCAGATGG + Intronic
1004745180 6:18502241-18502263 GGTCCCCATGGAAGGTCTGCAGG + Intergenic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003697 6:30986594-30986616 AGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006660654 6:35640869-35640891 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1007127396 6:39438421-39438443 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1009557887 6:65198215-65198237 TGTCCCACTGGAAGGTGTGCAGG + Intronic
1011249156 6:85352691-85352713 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1012055514 6:94403587-94403609 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1012919628 6:105208001-105208023 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1013385595 6:109627217-109627239 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1013637824 6:112045990-112046012 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1013755127 6:113452579-113452601 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1015520115 6:134121549-134121571 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1015914066 6:138197252-138197274 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1015938603 6:138426744-138426766 GGACCCAATACAGGGTCTGAAGG + Intronic
1016474693 6:144414240-144414262 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1017072197 6:150585370-150585392 TGTCCCACTGGAGGGTCCTCAGG - Intergenic
1017600916 6:156080145-156080167 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1017637279 6:156455926-156455948 GTTCCCTCTGGAGGATCTGCAGG + Intergenic
1017669277 6:156754760-156754782 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1017862998 6:158416338-158416360 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1018191900 6:161316330-161316352 GGTCCCACTGGGAGGTCTTCAGG - Intergenic
1018256136 6:161921256-161921278 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG + Intronic
1018355615 6:163011917-163011939 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1018859755 6:167703035-167703057 GGTCCCACTGGAAGGTCTGCAGG + Intergenic
1018886776 6:167945284-167945306 GGTCCCACGGGAAGGTCTTCAGG + Intronic
1019070408 6:169340742-169340764 GAGCTCACTGCAGGGTCTGCGGG + Intergenic
1019098949 6:169611782-169611804 GGTCCCACTGGAAGGTCTTCAGG + Intronic
1020111856 7:5452023-5452045 GGAGCCACTTGGGGGTCTCCAGG - Intronic
1020740794 7:12014626-12014648 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1020832234 7:13107070-13107092 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1021165330 7:17332437-17332459 TGTCCCACTGGAAGGTCTGCGGG - Intronic
1022517940 7:30987645-30987667 GTCCCTGCTGGAGGGTCTGCTGG + Intronic
1024063601 7:45716015-45716037 GGACCCACTGGAGACTTTGAGGG + Exonic
1024784851 7:52895550-52895572 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1024923455 7:54586720-54586742 TGTCCCACTGGAGAGTCTTCAGG + Intergenic
1025270722 7:57511213-57511235 TGACCCACTGGAAGGTCTTCAGG + Intergenic
1026653127 7:72233253-72233275 GGACCCACTGCAGGGTTGGAAGG + Intronic
1026947968 7:74328211-74328233 GGACCCAATGCGGGGACTGCCGG + Intronic
1027475441 7:78625023-78625045 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1027545790 7:79525921-79525943 TGTCCCACTGGAGGATCTTCAGG + Intergenic
1027839022 7:83283490-83283512 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1028239464 7:88402031-88402053 TGTCCCACTGGAGGATCTTCAGG + Intergenic
1029420829 7:100471097-100471119 GAACCCACTGGAGAGTGTGCAGG - Intronic
1029566622 7:101342824-101342846 GGACACCCTGGAGGGACTGGAGG + Intergenic
1030102586 7:105959609-105959631 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1030573722 7:111259949-111259971 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1030707654 7:112711258-112711280 TGTCCCACTGGAAGGTCTTCGGG - Intergenic
1031413655 7:121469797-121469819 TGAGCCACTGGAAGGTCTTCGGG + Intergenic
1031674510 7:124592365-124592387 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1032735086 7:134685061-134685083 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1032857907 7:135851540-135851562 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1032908623 7:136403106-136403128 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1032977847 7:137245708-137245730 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1033059617 7:138093550-138093572 CGTCCCACTGGAGGTTCTTCCGG + Intronic
1033345614 7:140523482-140523504 GGACACACTGGAGCCACTGCAGG + Intronic
1033429619 7:141277420-141277442 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1034544596 7:151781580-151781602 GTAGCCACTGAATGGTCTGCAGG + Intronic
1035064152 7:156093333-156093355 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1035262624 7:157671488-157671510 GGACAGATGGGAGGGTCTGCAGG + Intronic
1036113549 8:5933140-5933162 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1036657927 8:10689936-10689958 GGACCCGCAGGAGTGTCTGGAGG + Intronic
1036734083 8:11293115-11293137 TGCCCCACTGGAAGGTCTTCAGG - Intronic
1037149494 8:15618524-15618546 TGTCCCACTGGGGGGTCTTCAGG + Intronic
1037414614 8:18636109-18636131 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1037459000 8:19090323-19090345 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1037538647 8:19851242-19851264 GCTGCCTCTGGAGGGTCTGCTGG + Intronic
1037867159 8:22454321-22454343 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1037899366 8:22678511-22678533 CACCCCACTGGAGCGTCTGCTGG - Intergenic
1037914822 8:22766640-22766662 GGAGCCAGTGGAGGGCATGCTGG + Intronic
1038628140 8:29214476-29214498 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1038813174 8:30872622-30872644 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1039305930 8:36262796-36262818 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1039589692 8:38736009-38736031 GGAGCCACTGGAGGGAGTACCGG - Intronic
1040275894 8:46013490-46013512 AGGCCCAGTGCAGGGTCTGCCGG + Intergenic
1040276746 8:46017751-46017773 GGACCCAGTGCAGAGGCTGCTGG + Intergenic
1040277638 8:46022076-46022098 GGGCCCAGTGTAGGGGCTGCAGG + Intergenic
1040750738 8:50703411-50703433 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1040905152 8:52461419-52461441 GGACCTTCTGCAGGGGCTGCCGG + Intergenic
1041351621 8:56952762-56952784 GGACCCACTGAAGGGTGAGGAGG - Intergenic
1041861814 8:62522572-62522594 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1042156842 8:65853395-65853417 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1042406326 8:68409333-68409355 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1042849977 8:73207152-73207174 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1043759172 8:84044537-84044559 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1043981912 8:86652695-86652717 TGCCCCACTGGAAGGTCTTCAGG + Intronic
1044117399 8:88351480-88351502 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1044414682 8:91923999-91924021 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1044518004 8:93162171-93162193 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1045334537 8:101187444-101187466 TGTCCCACTGGAGGGACTCCAGG - Intronic
1045444361 8:102244707-102244729 TGTCCCACTGGAAGGTCTCCAGG - Intergenic
1045544789 8:103118828-103118850 GGAGCCACTGAAGGGTCTTCAGG + Intergenic
1047850778 8:128855025-128855047 TGGCCCACTGGTGGGTCTCCAGG + Intergenic
1047932190 8:129739926-129739948 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
1048339761 8:133529539-133529561 GGACCCAGAGGAGGGGCTCCGGG + Intronic
1048602814 8:135936498-135936520 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1048789674 8:138088542-138088564 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
1049595508 8:143481522-143481544 GGAGCCCCTGGCGGGTCTGGAGG - Intronic
1050285055 9:4092647-4092669 CATCCCACTGGAGGGTCTTCAGG + Intronic
1050848609 9:10256290-10256312 TGTCCCACTGGAAGGTCTTCGGG + Intronic
1050889072 9:10800366-10800388 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1051474909 9:17495339-17495361 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1051560517 9:18436106-18436128 GGGCACCCTGGAGGGTTTGCAGG + Intergenic
1051647497 9:19283279-19283301 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1051867225 9:21696112-21696134 GGACCCCTTGGAGGGCCTGGGGG - Intergenic
1052744643 9:32428375-32428397 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1053025497 9:34725385-34725407 GGAGCAACTGGATGGACTGCTGG + Exonic
1053037027 9:34834447-34834469 GGAGCAACTGGATGGACTGCTGG + Intergenic
1053486657 9:38462208-38462230 GGGCCCACTGCGGGATCTGCAGG - Intergenic
1054978511 9:71176259-71176281 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1055179789 9:73371252-73371274 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1056139697 9:83663996-83664018 GGAAGCACTGGAGGCTCTTCGGG - Exonic
1056329559 9:85510474-85510496 GAACCCACTAGAAGGTCTGCTGG - Intergenic
1056748604 9:89327672-89327694 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1056961425 9:91127404-91127426 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1057301979 9:93891812-93891834 TGACCCACAGGGAGGTCTGCAGG - Intergenic
1057452809 9:95180208-95180230 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1057723901 9:97554847-97554869 GGAGCCACTGGGGGATGTGCAGG + Intronic
1058963078 9:110009809-110009831 GGACACACATGAGGATCTGCAGG - Intronic
1059183286 9:112240765-112240787 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1059526673 9:114997802-114997824 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1059718969 9:116940420-116940442 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1059951522 9:119467607-119467629 TGTCCCACTGGAAGGTCTACAGG - Intergenic
1060870500 9:127036008-127036030 GCTCCCAGAGGAGGGTCTGCTGG + Intronic
1061034821 9:128107625-128107647 GAACCAACAGGAGGGTCTGCTGG - Exonic
1061225490 9:129278755-129278777 GGACCCACAGGAGGGTGGTCAGG - Intergenic
1061311385 9:129765205-129765227 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1061627156 9:131847551-131847573 GGACAGACTGGGGGGTCTGAAGG - Intergenic
1061872479 9:133528250-133528272 GGAACCAGGGGAGGGTCTCCTGG - Intronic
1062618228 9:137407576-137407598 GGACCCTCTGAAGGGCCTGCGGG - Intronic
1185943829 X:4352441-4352463 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1185951213 X:4436371-4436393 GGCCCCAGAGGAGGGTCTCCAGG + Intergenic
1186296323 X:8153031-8153053 GGTCCCACTGGAAGGTCTTCAGG + Intergenic
1187234285 X:17452416-17452438 GGCCCCACTGCAGGGTCACCGGG - Intronic
1187395264 X:18913859-18913881 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1187675042 X:21707857-21707879 GGACTCACTGATGTGTCTGCAGG - Intronic
1187762288 X:22601150-22601172 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1188442473 X:30226239-30226261 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1189132290 X:38512559-38512581 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1190119563 X:47649438-47649460 GGACTCACGGGAGGGTATGCGGG + Intronic
1190245272 X:48686774-48686796 GGACCCACTGGAGGGCCTGTGGG - Exonic
1190398582 X:50009477-50009499 GATCACACTTGAGGGTCTGCAGG - Intronic
1191251119 X:58260649-58260671 GGACCAAGTGCAGGGACTGCTGG - Intergenic
1192181134 X:68916475-68916497 GGACCCAGTGCAGGGGCTGCAGG + Intergenic
1193184952 X:78501265-78501287 GGACCAACTGGAGTGGCTGAGGG + Intergenic
1193372935 X:80720302-80720324 TGTCCCACTGGAAGGTCTTCCGG - Intronic
1194473631 X:94331436-94331458 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1194640304 X:96396112-96396134 CGTCCCACTGGAAGGTCTTCAGG - Intergenic
1195254746 X:103080821-103080843 GTCCCCACTGAAGGCTCTGCAGG + Intronic
1195542881 X:106083321-106083343 GTTTCCACTGAAGGGTCTGCTGG + Intergenic
1195551117 X:106172571-106172593 CGTCCCACTGGAAGGTCTTCAGG + Intronic
1196690867 X:118557029-118557051 GAAACCACTGGAGAATCTGCTGG + Intronic
1197675588 X:129326467-129326489 GGTCCCAGTGGAGAGTCTGTGGG - Intergenic
1197767216 X:130067032-130067054 GGCCCCCATGGAGGGGCTGCTGG - Exonic
1197774613 X:130110977-130110999 GGACCGACGGGAGGGACTGCGGG + Intergenic
1197833689 X:130672401-130672423 TGGCCCACTGGATGGTGTGCGGG - Intronic
1197877951 X:131131441-131131463 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1199940622 X:152623300-152623322 TGTCCCACTGGAAGGTCTCCAGG - Intergenic