ID: 1112324310

View in Genome Browser
Species Human (GRCh38)
Location 13:98433188-98433210
Sequence AAGCCGTAACCTAAGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112324305_1112324310 -8 Left 1112324305 13:98433173-98433195 CCCATGGACCCCGCAAAGCCGTA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG 0: 1
1: 0
2: 0
3: 0
4: 60
1112324303_1112324310 1 Left 1112324303 13:98433164-98433186 CCACTGCGCCCCATGGACCCCGC 0: 1
1: 0
2: 1
3: 23
4: 198
Right 1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG 0: 1
1: 0
2: 0
3: 0
4: 60
1112324302_1112324310 2 Left 1112324302 13:98433163-98433185 CCCACTGCGCCCCATGGACCCCG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG 0: 1
1: 0
2: 0
3: 0
4: 60
1112324306_1112324310 -9 Left 1112324306 13:98433174-98433196 CCATGGACCCCGCAAAGCCGTAA 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG 0: 1
1: 0
2: 0
3: 0
4: 60
1112324304_1112324310 -7 Left 1112324304 13:98433172-98433194 CCCCATGGACCCCGCAAAGCCGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG 0: 1
1: 0
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112324310 Original CRISPR AAGCCGTAACCTAAGAGCAG AGG Intronic
902908098 1:19574112-19574134 AAGCAGAAACCAGAGAGCAGAGG - Intergenic
906111445 1:43324963-43324985 AATCTTTATCCTAAGAGCAGAGG + Intergenic
912556922 1:110523219-110523241 AAGCTGTAACTTCAGAGCTGGGG + Intergenic
919064882 1:192682243-192682265 AAGCAGTAAATCAAGAGCAGAGG - Intergenic
924314018 1:242776931-242776953 AACCTGTGACCTGAGAGCAGAGG + Intergenic
1070458018 10:76636713-76636735 AGGCTGAAACCCAAGAGCAGTGG - Intergenic
1077639276 11:3866704-3866726 AAGCCAGTACCTAAGAGCACTGG + Intronic
1078601106 11:12731824-12731846 AAGCCATATCCTAAGAGAAATGG - Intronic
1080251567 11:30239418-30239440 AAGCCTTTCCCTTAGAGCAGAGG - Intergenic
1084026226 11:66451715-66451737 AAGCCTTGACCTAACAGGAGAGG + Intronic
1095422504 12:42039997-42040019 AAGTCCTAACCTGGGAGCAGAGG + Intergenic
1101907136 12:108835554-108835576 AAGCCAGTGCCTAAGAGCAGAGG - Intronic
1106875530 13:34068022-34068044 AAGCAGAGACCTAGGAGCAGAGG + Intergenic
1112324310 13:98433188-98433210 AAGCCGTAACCTAAGAGCAGAGG + Intronic
1123725358 15:23096104-23096126 AAGCCCTGACCTAAGAGCCAAGG + Intergenic
1129451667 15:75654606-75654628 AAGACTTAACCTGAGAGCTGAGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137321659 16:47389854-47389876 AAGCAGTAACGTAGGAGTAGAGG + Intronic
1155616665 18:27729337-27729359 AAGCTGTATCCTAATACCAGTGG - Intergenic
1156214080 18:34978002-34978024 GAGCCGTAACCTCGGAGAAGGGG + Intronic
1156344674 18:36246338-36246360 AAGCCGTATCCTTAGAGGAAGGG - Intronic
1162233886 19:9289850-9289872 AAGCAGTAAAATATGAGCAGAGG - Intergenic
1168451013 19:56466623-56466645 AAGCATTAACCTTATAGCAGGGG - Intronic
925339305 2:3125286-3125308 AAGCCTTACCCTAAGTCCAGCGG + Intergenic
927415560 2:22876322-22876344 AAAACAAAACCTAAGAGCAGTGG + Intergenic
930892551 2:56407825-56407847 AGGCCGTTATCTAAGATCAGTGG + Intergenic
942204216 2:173603273-173603295 AAGCCTTAACCTTAGAGCCTAGG - Intergenic
944663557 2:201940605-201940627 AAGAGGTAACCTCAGAGCCGGGG - Intergenic
945722903 2:213440863-213440885 AAGCATTAACCAAAGAGCAAAGG + Intronic
946817377 2:223593051-223593073 AAGCAGCAACCTTAGAGGAGAGG + Intergenic
973034988 4:45395118-45395140 AAGCATTATCCTTAGAGCAGAGG + Intergenic
973638863 4:52884349-52884371 AAGCTGTAACCCCAGAGCACTGG + Intronic
975351590 4:73353142-73353164 AAGTTGAAACCTAAGAGAAGTGG + Intergenic
976641292 4:87341457-87341479 AAGCCAAAACCTAATTGCAGTGG - Intronic
979611550 4:122694345-122694367 AAGTGGTAACCTCAGAGCAAAGG + Intergenic
981489513 4:145325026-145325048 AAGCTCTCACCTAACAGCAGAGG - Intergenic
982444185 4:155471146-155471168 AAGTAGTTACCTTAGAGCAGTGG + Intergenic
983337737 4:166418345-166418367 AAGTGGAAACCAAAGAGCAGGGG - Intergenic
983372714 4:166882471-166882493 AAGCACTCACCTAAAAGCAGTGG - Intronic
992299097 5:75359327-75359349 AAGACGTAACACAAGAGAAGTGG - Intronic
997481987 5:134192672-134192694 AAGTAGTAAAATAAGAGCAGTGG + Intronic
1004927969 6:20433931-20433953 AAGCAGTAAACCCAGAGCAGGGG - Intronic
1006248716 6:32762243-32762265 ACGCCCTGATCTAAGAGCAGAGG - Intronic
1010563303 6:77377599-77377621 AAGCCGTGTCTGAAGAGCAGAGG - Intergenic
1025740658 7:64192999-64193021 ACGCAGTAAGCTGAGAGCAGTGG + Intronic
1032168712 7:129566338-129566360 ACAACCTAACCTAAGAGCAGAGG + Intergenic
1036452368 8:8880196-8880218 AAGGTGTAACTTAAGAGTAGGGG - Intronic
1036622567 8:10434443-10434465 AAGAAGGAACCTAAGAGCTGTGG + Intergenic
1037800690 8:22033703-22033725 AAACCTTATCCTAAGAGAAGTGG - Intronic
1037822593 8:22142082-22142104 AAGCTGTAACAAAAAAGCAGGGG + Intergenic
1043061377 8:75508867-75508889 ATGCTCTATCCTAAGAGCAGTGG + Intronic
1060398204 9:123331207-123331229 AATCCATATCCTAAAAGCAGAGG + Intergenic
1060423061 9:123483293-123483315 AATCCCTACCCCAAGAGCAGGGG + Intronic
1062685189 9:137809049-137809071 AAGCCAGAAACAAAGAGCAGAGG + Intronic
1186055836 X:5649023-5649045 AACCCCTAACCTAAGAGCTTTGG - Intergenic
1186320134 X:8415178-8415200 AAGCCTTAGCCTCAGAGCTGTGG - Intergenic
1186483197 X:9911902-9911924 AAGCTGTAACATCAGTGCAGTGG + Intronic
1187056680 X:15747325-15747347 AACCCGTAACCTATGAGCTTTGG - Intronic
1187318627 X:18220819-18220841 AAGCAGTTACCTCAGAGCCGCGG - Exonic
1193991585 X:88314703-88314725 AAGCAGTAACCAAAGAGAGGAGG - Intergenic
1199935020 X:152564688-152564710 AAGTTGTAACCTAAGAGCTTGGG + Intergenic