ID: 1112324919

View in Genome Browser
Species Human (GRCh38)
Location 13:98437748-98437770
Sequence TTCTCTCGGTCCCACCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112324915_1112324919 26 Left 1112324915 13:98437699-98437721 CCGTGAAGAAAGGCAGACCTGTA 0: 3
1: 15
2: 48
3: 87
4: 262
Right 1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG 0: 1
1: 1
2: 3
3: 13
4: 135
1112324916_1112324919 9 Left 1112324916 13:98437716-98437738 CCTGTATAGCTTCTCCGCTTTGT 0: 2
1: 0
2: 0
3: 2
4: 69
Right 1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG 0: 1
1: 1
2: 3
3: 13
4: 135
1112324917_1112324919 -5 Left 1112324917 13:98437730-98437752 CCGCTTTGTCTTTTTGCTTTCTC 0: 2
1: 0
2: 9
3: 189
4: 1646
Right 1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG 0: 1
1: 1
2: 3
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112324919 Original CRISPR TTCTCTCGGTCCCACCAGCC TGG Exonic
901003199 1:6159300-6159322 GTCGCTCTGTCCCCCCAGCCAGG + Intronic
903012350 1:20340117-20340139 TTCTCTCGCCCCCTCCTGCCTGG + Intronic
904986038 1:34549642-34549664 TTCTCTCAGGCACACCAGCCTGG + Intergenic
907430538 1:54408738-54408760 TTCTCTCCCTACCACCACCCTGG + Intronic
916691245 1:167192156-167192178 TTCTCTCAGGCTCACCAGACTGG + Intergenic
922803401 1:228374049-228374071 CTCTCAGGGTCCCACCAGCGTGG + Intronic
922967328 1:229701562-229701584 TTCTCTGGTTCTCAGCAGCCAGG - Intergenic
923628594 1:235634590-235634612 TTCCCTTGCTCCCACCAGCCTGG + Intronic
1067813928 10:49456814-49456836 TTCTCCAAGTCCCTCCAGCCAGG + Exonic
1069083651 10:64114929-64114951 TTCTCTGGCACCCACCATCCAGG - Intergenic
1069837727 10:71319623-71319645 TTCTCTCGGTCCCAGCTGCGGGG + Intronic
1071462965 10:85915988-85916010 TTCTCTCGTTCCCACCTGCCAGG + Intronic
1073328320 10:102655331-102655353 CCCTCTGGGTGCCACCAGCCTGG - Intronic
1076704357 10:132293233-132293255 CTCTCACGGTCCCTCCACCCAGG + Intronic
1077258492 11:1601732-1601754 TTCCCTTGGTCCAACCAACCTGG - Intergenic
1077370054 11:2177563-2177585 CTCTCTGAGTCCCTCCAGCCTGG + Intergenic
1077889962 11:6411626-6411648 TGCCCTCGGTCCCACCAGCAAGG + Intronic
1079343458 11:19632017-19632039 TACTCTGGTTCCCACCCGCCAGG + Intronic
1083679335 11:64344001-64344023 CTCTCTCGGTGCCTCCAGCAGGG - Exonic
1083729733 11:64646269-64646291 CTCCCTCCCTCCCACCAGCCTGG + Intronic
1084041120 11:66543302-66543324 TTCTCAGGACCCCACCAGCCAGG + Intronic
1084803033 11:71558255-71558277 TTCCCTTGGTCCAACCAACCTGG + Intronic
1089916461 11:122161530-122161552 TTCTCTCAATCCCAGCAGGCAGG - Intergenic
1090610142 11:128463716-128463738 TTCTCTCAGCCCATCCAGCCAGG + Intronic
1091995181 12:4987719-4987741 GTCTCTCGATCCCGGCAGCCAGG - Intergenic
1096616529 12:52836191-52836213 GCCTCTCACTCCCACCAGCCTGG - Intergenic
1098465670 12:70783744-70783766 GTCTCTTGGTGCCAGCAGCCTGG - Intronic
1100279382 12:93103826-93103848 TTCTCCCTGTACCCCCAGCCTGG + Intergenic
1102029277 12:109730679-109730701 TTCTCTGGGTTCCTGCAGCCTGG + Intronic
1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG + Intronic
1104760487 12:131295130-131295152 TCCACAGGGTCCCACCAGCCTGG - Intergenic
1104819288 12:131665655-131665677 TCCACAGGGTCCCACCAGCCCGG + Intergenic
1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG + Exonic
1112604432 13:100890271-100890293 TTCTCTAGGGTTCACCAGCCTGG + Intergenic
1121061308 14:90912715-90912737 TTCCCTAGGCCACACCAGCCAGG + Intronic
1121544384 14:94752699-94752721 TTCCCGCGGCCCCTCCAGCCTGG - Intergenic
1122905173 14:104798261-104798283 CTCTCTCTGTCCCGCCAGCCAGG + Intergenic
1127978768 15:64018587-64018609 TTCTCTGGGTCCCACAACCCAGG + Intronic
1128578353 15:68791456-68791478 TTCTAACTGTTCCACCAGCCAGG + Intronic
1128714571 15:69898388-69898410 TTCTCTCAGTACCACAAGCCTGG + Intergenic
1129671972 15:77612572-77612594 TTCTCCCAGTCCCCACAGCCTGG + Intergenic
1129681789 15:77662321-77662343 TTCTCTCATTCCCCACAGCCAGG - Intronic
1131472505 15:92709191-92709213 TGCTCTCAGCCCCATCAGCCTGG + Intronic
1133370152 16:5240458-5240480 TTTTGTCGGTCCCACCTGGCGGG + Intergenic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1134550348 16:15135968-15135990 CTGGCTCGGGCCCACCAGCCGGG - Intronic
1135422409 16:22314005-22314027 TTCTCTCAACCCCACCCGCCAGG - Intronic
1138049328 16:53759982-53760004 TTCTCTCAATCCCAACAGCCAGG - Intronic
1141293311 16:82741317-82741339 TTTTCTCTCTCCCACCTGCCTGG + Intronic
1142065538 16:88060279-88060301 CTCTCTGGGTCTCCCCAGCCTGG + Intronic
1142142028 16:88476736-88476758 CTCCCTCGGTGCCAACAGCCTGG - Intronic
1142697066 17:1639638-1639660 GTCTCTGGGTCCTGCCAGCCAGG - Exonic
1142876936 17:2856820-2856842 TTCTGTCGCTCCAACCATCCTGG + Intronic
1143013122 17:3877176-3877198 TACTCTCAGTCCCAGCAGCAGGG - Intronic
1143928853 17:10399509-10399531 TTCTCTGGGTCCCAACACCATGG - Intronic
1145851964 17:28108709-28108731 TTCTGGCCTTCCCACCAGCCAGG - Intronic
1147646913 17:42039671-42039693 TTCCCTCGGCCCATCCAGCCTGG - Intronic
1149567487 17:57650364-57650386 TTCTCTCTGTCCCAACCCCCAGG - Intronic
1149649167 17:58266010-58266032 TTCTCTCCCTCCTTCCAGCCTGG + Intronic
1152434087 17:80264588-80264610 TTCTATCGGACCCATCACCCCGG + Intronic
1154293868 18:13133185-13133207 TTCTCCCGGGCCCACCACACAGG + Intergenic
1156355828 18:36339265-36339287 TTCTATGGGCCCCACCATCCAGG + Intronic
1160343856 18:78113203-78113225 TTCTTTTTCTCCCACCAGCCAGG + Intergenic
1160753416 19:746228-746250 CTCTCTCTGTCCCTCCTGCCTGG + Intronic
1161930749 19:7337940-7337962 TTCTCTGGGGTCCAACAGCCTGG + Intergenic
1163303740 19:16464069-16464091 TCCTCTTGGGCACACCAGCCAGG - Intronic
1164600877 19:29562517-29562539 TTCTCTTGACCCCACCAGCTGGG - Intronic
1165729541 19:38135924-38135946 TGCCCTCGCTGCCACCAGCCAGG + Intronic
1168189644 19:54728326-54728348 ATCTGTAGGTGCCACCAGCCTGG - Intronic
925722868 2:6845426-6845448 TTCTCTCTTTCCCTCCACCCTGG - Intronic
927824608 2:26299266-26299288 TACTCTCGGGTCCACCAGACTGG - Intergenic
928707280 2:33964064-33964086 GTCTCTCTGTGTCACCAGCCAGG + Intergenic
931248438 2:60510055-60510077 TTCTCACGTCCCCACCACCCTGG + Intronic
931641044 2:64381259-64381281 TTCTCCCGGTTCCTTCAGCCAGG - Intergenic
935862234 2:107345571-107345593 TGCCCTCAGACCCACCAGCCCGG + Intergenic
938759691 2:134412711-134412733 TTCTCTCTGCCCCACCCCCCAGG + Intronic
939284800 2:140115060-140115082 ACTTCTCAGTCCCACCAGCCTGG + Intergenic
941268692 2:163397732-163397754 TTCTCTGGGACTCATCAGCCTGG - Intergenic
942248295 2:174026615-174026637 TCCTCTCTCTCCCTCCAGCCTGG + Intergenic
944414341 2:199467868-199467890 TCCTCTCGGTCTCAGCATCCAGG + Intronic
1172737035 20:37134504-37134526 TTCCCTTGCTCCCGCCAGCCTGG - Intronic
1173858767 20:46268532-46268554 TTCCCTCCCTCCCACCACCCCGG + Intronic
1175124900 20:56744064-56744086 CTCTCTCGGTGCCACCAAGCAGG + Intergenic
1175125263 20:56746776-56746798 TTCTCTGGGGCCTGCCAGCCAGG - Intergenic
1175912835 20:62412928-62412950 GACTCCCGGTGCCACCAGCCTGG - Intronic
1175971504 20:62688848-62688870 ATGTCTCCTTCCCACCAGCCTGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1180108132 21:45633284-45633306 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108147 21:45633353-45633375 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108158 21:45633421-45633443 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108185 21:45633558-45633580 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108212 21:45633695-45633717 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108237 21:45633832-45633854 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108264 21:45633969-45633991 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108279 21:45634038-45634060 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108290 21:45634106-45634128 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108315 21:45634243-45634265 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180108344 21:45634380-45634402 TCTTCTCAGTCCCACCAGCACGG - Intergenic
1180846507 22:18985773-18985795 GTCCCTCGGTCCCACGAGCCAGG + Intergenic
1181505524 22:23353792-23353814 TCCTCTCCATCCCACCAGCCAGG - Intergenic
1182527147 22:30927559-30927581 TTCTCTCTCTTCCACCAGACTGG + Intronic
1184733909 22:46386626-46386648 GTCCCTCCGTCCCACGAGCCAGG - Intronic
1184796844 22:46737921-46737943 TGCACCCGGTCCCCCCAGCCGGG + Intronic
950129443 3:10531977-10531999 TTCTCCCCGCCCCACCACCCTGG + Intronic
950475137 3:13210236-13210258 CTCACTGGGTCCCCCCAGCCTGG - Intergenic
950765942 3:15273030-15273052 TCCTCTCGTTCCCAGCAGCTTGG - Intronic
951262467 3:20526715-20526737 TTGTCTCTCTTCCACCAGCCAGG + Intergenic
954316134 3:49802917-49802939 CTCTCTGGGTCCGACCATCCGGG + Intergenic
959946016 3:112126017-112126039 TTCTCTCGGTCCTCACATCCTGG + Intronic
960972835 3:123151640-123151662 ACCTGTCGGTCCCAGCAGCCAGG - Intronic
961625455 3:128259652-128259674 TTCTCTGTGCGCCACCAGCCTGG + Intronic
961788325 3:129360621-129360643 CTCACTGGGTCCCCCCAGCCTGG + Intergenic
962060314 3:131919962-131919984 TTCTCTCATTCTCCCCAGCCTGG + Intronic
964187381 3:153963355-153963377 TTCTCTAGGTCACAGCAGCCTGG + Intergenic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
985717695 5:1471875-1471897 TTCTCTTGCTCTCTCCAGCCAGG - Intronic
985997778 5:3606348-3606370 TTCTCTAGGTCCCAGCTGCCTGG - Intergenic
988330502 5:29832858-29832880 TTCTCTTGGTCTCACCTACCAGG + Intergenic
988909799 5:35827618-35827640 TTCTCTCAGGACCACCAGCCTGG - Intergenic
995245749 5:109933373-109933395 TTCTCTTGGTCTCCCCAGCATGG - Intergenic
999650096 5:153756653-153756675 TTCTCTAGGTCCAACCAAGCTGG + Intronic
1002306844 5:178288539-178288561 GGCTCTTGGTCCCTCCAGCCTGG - Intronic
1003311790 6:4975245-4975267 TCCTCTCTGTCCCGCCATCCAGG + Intergenic
1003311810 6:4975332-4975354 TCCTCTCTGTCCCGCCATCCAGG + Intergenic
1004797464 6:19103558-19103580 TTCTCTCAGTCCCACAAAGCAGG - Intergenic
1005028954 6:21491655-21491677 TCCTCACGGTCCCTCCAGCATGG + Intergenic
1006628565 6:35414898-35414920 TTCTCACCCTCCCCCCAGCCAGG + Intronic
1008232482 6:49000424-49000446 TTATCTCACTCCCACCAACCAGG + Intergenic
1010011491 6:71052263-71052285 TTCTCTCTGTCCCACCAGCCTGG - Intergenic
1015024735 6:128519958-128519980 TTCTCTCTTCCCCACTAGCCCGG + Intronic
1018765321 6:166928278-166928300 TTCTCACCGTCCCATCTGCCTGG + Intronic
1020930623 7:14388863-14388885 TTCTCTCTCTCCTACCAACCTGG + Intronic
1023218843 7:37897342-37897364 TTGTCTCCATCCCTCCAGCCTGG - Intronic
1028487663 7:91377728-91377750 ATCTCTCCATCCCACCAGGCTGG - Intergenic
1029499685 7:100921092-100921114 TTCTCTTGGTTCCACCAGCCTGG + Intergenic
1033265664 7:139884539-139884561 CTCTCTCGGTACCCACAGCCTGG - Intronic
1033663768 7:143422367-143422389 TTCCCCAGGTCCCCCCAGCCTGG - Intergenic
1034569683 7:151945272-151945294 TTCTCTCAGTTCCAGAAGCCAGG + Intergenic
1036709130 8:11067137-11067159 TTCTCCCCTCCCCACCAGCCTGG - Intronic
1037176398 8:15951510-15951532 TTCTCTCGGTGTCACAGGCCTGG - Intergenic
1037664151 8:20953464-20953486 TTCTCTGGGTTCCACAAGGCTGG - Intergenic
1041194694 8:55389109-55389131 TTGTCTCGCTGCCACCAGCTAGG + Intronic
1042184257 8:66121276-66121298 GTTTCTGAGTCCCACCAGCCTGG - Intergenic
1046609445 8:116408134-116408156 TTCTGTCTGTCCCAGTAGCCAGG + Intergenic
1046665314 8:116995747-116995769 TTCCCCTGCTCCCACCAGCCTGG - Intronic
1048553694 8:135456439-135456461 TTCTCTGTGTCCCCCCAGCTTGG - Intergenic
1049689598 8:143952869-143952891 TCCCCTCCCTCCCACCAGCCAGG + Intronic
1050131817 9:2420708-2420730 TTCTCTCTGTCCCAATTGCCAGG - Intergenic
1056284927 9:85078107-85078129 TTCACTCCCTCCCTCCAGCCTGG - Intergenic
1061908481 9:133710872-133710894 TGCCCTGGGTGCCACCAGCCAGG + Intronic
1188720544 X:33518346-33518368 CTCTCTCTGTCCCCCCAGGCTGG + Intergenic
1190735393 X:53252492-53252514 TTCTCTCAGACCCCCCAACCTGG + Intronic
1197648810 X:129043227-129043249 CTCTCTCTGTTCCACCATCCGGG + Intergenic