ID: 1112325909

View in Genome Browser
Species Human (GRCh38)
Location 13:98442702-98442724
Sequence CTTCCCTGCTCCTCCGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112325909_1112325912 -3 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325912 13:98442722-98442744 AAGAACCCGTGATAGGCTCATGG 0: 1
1: 0
2: 0
3: 4
4: 58
1112325909_1112325913 -2 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325913 13:98442723-98442745 AGAACCCGTGATAGGCTCATGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1112325909_1112325919 29 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325919 13:98442754-98442776 CCTCATCAGATCTCACCTGTGGG 0: 1
1: 0
2: 2
3: 4
4: 146
1112325909_1112325911 -10 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325911 13:98442715-98442737 AGCAGGGAAGAACCCGTGATAGG 0: 1
1: 0
2: 1
3: 7
4: 93
1112325909_1112325916 6 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325916 13:98442731-98442753 TGATAGGCTCATGGGAAACGAGG 0: 1
1: 0
2: 0
3: 11
4: 80
1112325909_1112325917 28 Left 1112325909 13:98442702-98442724 CCCGAAGCGGAGGAGCAGGGAAG 0: 1
1: 0
2: 5
3: 37
4: 376
Right 1112325917 13:98442753-98442775 GCCTCATCAGATCTCACCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112325909 Original CRISPR CTTCCCTGCTCCTCCGCTTC GGG (reversed) Intronic
900378484 1:2372075-2372097 CTTCCCCACTCATCCGCTGCTGG - Intronic
900783211 1:4631329-4631351 CTGCCCTTGTCCTCGGCTTCTGG - Intergenic
901595046 1:10378250-10378272 GTTCCCTGCTCCTCTCCATCTGG + Intronic
901876921 1:12172139-12172161 CTTCCCTCCTTGCCCGCTTCTGG - Intronic
902642545 1:17776007-17776029 CTTCCCTGAACCTCAGCATCTGG - Intronic
902797118 1:18807176-18807198 CTTCCCTCCTCCTGTGCTCCTGG - Intergenic
902868628 1:19298357-19298379 CTTCCTTGCTCCTCAACTTGCGG + Intergenic
902911339 1:19599731-19599753 AATCCCAGCTCCTCCACTTCTGG - Intronic
903025490 1:20427239-20427261 CGTCACTGCTCCTCTGCTTTTGG + Intergenic
903697392 1:25217977-25217999 CTGCCCTGCTCCTGCCCATCAGG - Intergenic
906100161 1:43255222-43255244 CTGCTCTGCTCCTCCATTTCTGG + Intronic
906778177 1:48548601-48548623 CTGTCCTGCTCCTCCCCTTGTGG + Intronic
906809750 1:48813794-48813816 CTTCTTTGCTCCTTCTCTTCTGG + Intronic
907523180 1:55038341-55038363 TTTCCCTGCTGCTCCCCTTTGGG - Intergenic
907758808 1:57337765-57337787 CTTCCCTGCTCATCGGCAACAGG + Intronic
908534645 1:65066741-65066763 CCTCCCTCCTCCTCCTCCTCCGG + Intergenic
912248543 1:107987474-107987496 CTTCCTTGCTCCTCAACTTGCGG - Intergenic
912470025 1:109900484-109900506 CTTCCCTACTCCTAATCTTCTGG + Intergenic
915301268 1:154952927-154952949 CTTCTCTCCTCCTCCCCTCCTGG + Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
917515539 1:175704612-175704634 CTCCCCTGCTCCTCCCCATTGGG - Intronic
918940005 1:190981582-190981604 CTTCTTTGCTCCTCAGCTTGTGG - Intergenic
918995860 1:191758532-191758554 CCTCCCTCCTTCTCCACTTCTGG - Intergenic
920174115 1:204089543-204089565 CTTGCCTGCTACCCCTCTTCCGG - Intronic
920501353 1:206487338-206487360 CTCCCCAGTTCCTCCGCCTCCGG + Intronic
920684041 1:208095579-208095601 CTTCCCTGCTCCTCCTCTGTGGG + Intronic
1062901222 10:1148153-1148175 CCTCCCTGCTCCTCCCCATGAGG - Intergenic
1063602990 10:7498810-7498832 CCTCCCTCCTCCTCCTCTTTTGG - Intergenic
1064202914 10:13299789-13299811 CTTCCCCGCTCCCCGGCTCCTGG + Intronic
1064660146 10:17599634-17599656 CTTCCCTCGTCCTTCACTTCAGG + Intronic
1064709520 10:18109342-18109364 CTTGTCTGCTCCTCTGCTTCTGG - Intergenic
1065252682 10:23832508-23832530 CAGCCCTACTCCTGCGCTTCAGG - Intronic
1066287534 10:33982656-33982678 CTTGTCTGCTCATCAGCTTCTGG + Intergenic
1067248416 10:44566039-44566061 CATCCGTGCTCCTTCGCTCCTGG + Intergenic
1068135377 10:52947743-52947765 CTTACCTGCTTCTCCCTTTCAGG - Intergenic
1073577626 10:104639562-104639584 CAGCCCTGCTCCTCCCCTTCGGG - Intergenic
1074490834 10:113938258-113938280 CATCTCCGCTCCTCCCCTTCTGG + Intergenic
1075912529 10:126137544-126137566 ATTCCCTGCTCCTCCATCTCTGG + Intronic
1076649597 10:131978801-131978823 GTTCACAGCTCCTCTGCTTCAGG - Intronic
1076685461 10:132196624-132196646 CTTGCCTGCTCCTGTGCTCCGGG - Intronic
1076902780 10:133347976-133347998 CCTCCCTGCCCCTCCTCTCCTGG + Intronic
1077322325 11:1947829-1947851 ATTCCCAGCTCCTCTGCCTCAGG - Intronic
1078096177 11:8298571-8298593 CTCTCCTGCTCCTCCTCTTGGGG + Intergenic
1078245875 11:9573315-9573337 CCTCGCTGCTCCTCCGGTGCTGG - Intergenic
1079823730 11:25164256-25164278 CTTCCTTGCTCCTCAGCTTTTGG - Intergenic
1079871292 11:25801439-25801461 CTTCCCTGCTCCTCAGCTTGCGG - Intergenic
1080502634 11:32885292-32885314 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1080618654 11:33968128-33968150 CTTCCCTGACCCTCCAATTCAGG + Intergenic
1080618664 11:33968161-33968183 CTTCCCTGACCCTCCAATTCAGG + Intergenic
1081312612 11:41592322-41592344 CTTCTCTGCTCATCTGCCTCTGG + Intergenic
1083116762 11:60467597-60467619 CTTCCCTGCTGCTTGACTTCAGG + Intronic
1083659779 11:64246708-64246730 CCTCCCTGCGCCACCGCCTCCGG + Exonic
1083845976 11:65333864-65333886 CTTCCCTGTTCCTCTGCCTCGGG - Exonic
1084265978 11:68005311-68005333 CCTCCCTGCCCCTGCGCCTCGGG - Intergenic
1084451521 11:69241622-69241644 CTTCCCTGCCCCTACGCTGAAGG + Intergenic
1084500374 11:69531510-69531532 CTTCTCTGCTCCTCTGCCTAGGG + Intergenic
1084522909 11:69675352-69675374 CTGCCCCGCGCCGCCGCTTCCGG - Intronic
1084609433 11:70192893-70192915 CCTCCCTGCCCCTCTGCTCCTGG - Intergenic
1084768678 11:71328629-71328651 CTTCCTTGCTGCTCTGCTCCAGG + Intergenic
1087046971 11:93850570-93850592 CTTCTCTCTTCCTCCGCCTCTGG + Intergenic
1088802631 11:113320335-113320357 CTCACCTGCTCGTCTGCTTCTGG - Intronic
1088845568 11:113663281-113663303 CTTCTCTGCTTCTCCCCTTTGGG + Intergenic
1088899129 11:114101909-114101931 CTTACCTGCCCCTCCCCATCTGG - Intronic
1089377645 11:118005862-118005884 CTGCCCAGCTCCTCCAGTTCTGG - Intergenic
1202805343 11_KI270721v1_random:3142-3164 ATTCCCAGCTCCTCTGCCTCAGG - Intergenic
1091445712 12:543302-543324 CATCCCAGCTCCTCAGCTCCGGG - Intronic
1091445759 12:543470-543492 CGTCCCAGCTCCTCAGCTCCAGG - Intronic
1091445815 12:543680-543702 CGTCCCAGCTCCTCAGCTCCAGG - Intronic
1091445847 12:543806-543828 CATCCCAGCTCCTCAGCTCCGGG - Intronic
1091445870 12:543890-543912 CGTCCCAGCTCCTCAGCTCCAGG - Intronic
1091445926 12:544100-544122 CGTCCCAGCTCCTCAGCTCCAGG - Intronic
1091777306 12:3192792-3192814 CTGCCCTCCTCCTCCTCCTCAGG - Intronic
1092760104 12:11802181-11802203 CTTCCCTGCTTCTCCAAGTCTGG + Intronic
1093434340 12:19118462-19118484 CTTCCTTCCTCCTCCAGTTCTGG - Intergenic
1093516995 12:19999536-19999558 GTTCTCTGCTCCTCTACTTCAGG - Intergenic
1096209304 12:49750972-49750994 CCTCCCTGCCCCTCCTTTTCTGG + Intronic
1096513085 12:52142632-52142654 CATCCCTCCTCCTCAGCATCCGG + Intergenic
1096690953 12:53321426-53321448 GTTCCCTCCTCCACCGCCTCGGG - Exonic
1096785217 12:54013383-54013405 CTTCCTTTCTCCTCTCCTTCAGG - Intronic
1096805808 12:54140526-54140548 TTTCCATACTCCTCCCCTTCAGG - Intergenic
1097382270 12:58909151-58909173 CTTCCCTGCTGCTTCTCTCCAGG + Intronic
1098731426 12:74040372-74040394 CTTCCCTGCTCCTCAGCTTGTGG + Intergenic
1098736279 12:74110097-74110119 TTTCCTTGCTCCTCAGCTTGCGG - Intergenic
1099400902 12:82202993-82203015 CTTCCTTGCTCCTCAGCTTGAGG - Intergenic
1101461224 12:104896968-104896990 CTTTCCTGCTCCAGGGCTTCAGG + Intronic
1102669918 12:114609428-114609450 CTTCCTTGCTCCTCAGCTTGTGG + Intergenic
1103936221 12:124478434-124478456 CTTCTCTGCTCTTCAGCCTCCGG - Intronic
1104327360 12:127812132-127812154 CTTCCCTGCTGCTTCACTTCAGG - Intergenic
1105464922 13:20630913-20630935 CTTCCCTGGTCTTACCCTTCAGG + Intronic
1105647433 13:22336895-22336917 CTTTCTTGCTCCTCATCTTCTGG + Intergenic
1107357547 13:39583958-39583980 CTCCCCTCCTCCTCCGTGTCAGG + Intronic
1107960528 13:45554135-45554157 TTTCCCTACTCCTCAGCTCCTGG + Intronic
1108495257 13:51018566-51018588 TTTCCCTTCTCCTTGGCTTCTGG + Intergenic
1108528315 13:51304501-51304523 CTTCCCTGGGCCTGCTCTTCTGG + Intergenic
1108581747 13:51833921-51833943 CTTCATTGCTCCTCCTCTTTGGG - Intergenic
1112030536 13:95452545-95452567 CTTTCCAGCTCCTCAGCTGCTGG + Intronic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1113061985 13:106331842-106331864 CTCCTCTGCTCATCTGCTTCTGG + Intergenic
1113443962 13:110351409-110351431 CTACCCTGCTCCTCCCTTGCCGG + Intronic
1113545481 13:111145734-111145756 CTTCCCTGCTCTCTGGCTTCTGG - Intronic
1113981832 13:114282419-114282441 CTTCCCTGCTCGTCCGCGGACGG + Intronic
1114558025 14:23572833-23572855 CTTCCCTGCTCCTTAGGTGCAGG + Intronic
1114676409 14:24442982-24443004 CTTCCCTCCTCCGCCCTTTCCGG - Intergenic
1117722269 14:58638806-58638828 CTTCCCTCCTCCTCTGCCTTCGG + Intronic
1119854121 14:77886577-77886599 CTTGCCTGGTCCTCCACTGCTGG - Intronic
1120033033 14:79664231-79664253 CTTCACTGCTCCTCATCTACAGG - Intronic
1120308195 14:82797267-82797289 CTTCGCTGCTCCTCTGTTTCTGG - Intergenic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1121432163 14:93895228-93895250 CCTCCCAGCTGCTCCGCCTCTGG + Intergenic
1121741612 14:96256505-96256527 TTTCCCTCCTCCTCCTGTTCTGG - Intronic
1123033330 14:105461418-105461440 CTTCCCTGTACCTCCACCTCAGG + Intronic
1123640802 15:22401882-22401904 AGTCCCTGCTCCTCCGCTGAAGG - Intergenic
1124475523 15:30030288-30030310 TTTCCCTTCTCCCCAGCTTCTGG + Intergenic
1127109528 15:55652640-55652662 TTTTCCTGCTCCTCTGCTGCTGG - Intronic
1127613281 15:60657851-60657873 CTTCACTGCTCTTCAGGTTCTGG + Intronic
1127885440 15:63195632-63195654 GCTCCCTGCTCATCCACTTCAGG - Intronic
1128226838 15:66007645-66007667 CATCCTTTCTCCTCAGCTTCTGG - Intronic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1128460388 15:67862395-67862417 ATTACCTGCTCCACAGCTTCTGG - Intergenic
1128550241 15:68593725-68593747 CTTCACAGCTCATCCACTTCTGG - Intronic
1128664825 15:69530471-69530493 CTTTCCTGATCCTCAGCTCCAGG - Intergenic
1129333555 15:74839702-74839724 CTTCCCTGCAGCTCCCCTTGCGG - Exonic
1130014070 15:80173977-80173999 CTCCCATGCTCCTCTGCCTCTGG + Intronic
1130221363 15:82022328-82022350 CTTTCCTCCTACTCCCCTTCAGG + Intergenic
1130550008 15:84884357-84884379 CTCCCCTGCTCCTCCTCTCAAGG - Intergenic
1130767228 15:86883298-86883320 CTAACCAGCTCCTCAGCTTCAGG + Intronic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1132976114 16:2711957-2711979 CTTTCCTGCTCCACTGCTCCTGG - Intergenic
1133063166 16:3188531-3188553 CCTCCCTTCTCCCCCGCTTCCGG - Intergenic
1133736596 16:8620844-8620866 CTATCCTGCTCATCCTCTTCAGG + Intergenic
1133906631 16:10028416-10028438 CTTCCCAGCACCTCTGCATCTGG + Intronic
1134553038 16:15146946-15146968 CGTCCCAGCGCCTCCACTTCTGG - Intergenic
1135681281 16:24459500-24459522 CTTCCCTTCCCCTCCTCTACAGG - Intergenic
1135990491 16:27216031-27216053 CTTCCCCTCTCCTCCCCTCCTGG + Intronic
1136040617 16:27575965-27575987 CATCCCTGCTCCTCTACCTCAGG - Intronic
1136608251 16:31350978-31351000 CTTCCCTCCCTCTCCCCTTCTGG - Intergenic
1138235033 16:55374893-55374915 CTTTCCTGGTCCTGCGCTACAGG + Intergenic
1138354974 16:56370391-56370413 CTTCCCTGATCCTCAGCCCCTGG - Intronic
1138387828 16:56648194-56648216 CTTGCCTGCTTCTTCGCCTCTGG + Intronic
1138679555 16:58675108-58675130 TTCCCCAGCTCCTCCTCTTCTGG + Intronic
1138699569 16:58848121-58848143 CTTCCATGCTCCTAGGATTCTGG + Intergenic
1141297454 16:82783199-82783221 CTGCTCAGCTCCTCCCCTTCAGG + Intronic
1141732756 16:85833821-85833843 GGTCCCTGCTCCTCCGCAGCAGG + Intergenic
1142135210 16:88448803-88448825 CTTCCCTGCTTTGCTGCTTCAGG + Intergenic
1143410198 17:6704056-6704078 CCTCCCTGCCCCTCCTCTGCAGG - Exonic
1143464960 17:7130674-7130696 CTTCCCTCCCCCTGAGCTTCAGG + Intergenic
1143683048 17:8491917-8491939 ATTCCCTCCTCCTCCTCTCCAGG + Intronic
1143730958 17:8882501-8882523 ATTCCCTGCTTCCCCCCTTCAGG + Intronic
1143735605 17:8910116-8910138 CCTCCCTGCTCCTCTGCCCCAGG - Intronic
1144203201 17:12959924-12959946 CTTCCCTCCTGCACCGCTTTAGG - Intronic
1144951395 17:18996358-18996380 CTCCCCTCCTCCTCCCCTCCAGG + Intronic
1145055877 17:19703812-19703834 CTTCCCTGCTGCTGTGATTCTGG - Intronic
1146490514 17:33278141-33278163 CTCCCCTGCTCCCTGGCTTCAGG + Intronic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1147795504 17:43039572-43039594 CTTACCTGCTGCTCCTTTTCAGG - Intergenic
1148115277 17:45171695-45171717 CCTCCAGGCTCCTCAGCTTCTGG - Intergenic
1148482810 17:47971124-47971146 CTTTCCTCCACTTCCGCTTCAGG - Intronic
1148543795 17:48501579-48501601 CATCCCTGGGCCTCCCCTTCTGG - Intergenic
1148559723 17:48598926-48598948 CCTGCCAGCTCCTCCTCTTCTGG - Intronic
1149104259 17:52943292-52943314 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1149314018 17:55421941-55421963 CTCCCCGGCTCCTCCGCCCCGGG + Exonic
1150280285 17:63926083-63926105 ATTCCCTCCTCCTTCGGTTCAGG + Intergenic
1151069026 17:71187118-71187140 CTTCCTTGGTCCTCAGCTTGCGG - Intergenic
1151429033 17:74050170-74050192 CTTCCCTGTTCCTCCCTTTTTGG - Intergenic
1151904863 17:77041114-77041136 CTTCCCTGCCCCTTGACTTCAGG + Intergenic
1151961358 17:77407659-77407681 CCTGCCTGCTCCTCCGCCCCAGG + Intronic
1152579441 17:81159645-81159667 CTTCCCTTCTGCTCTGCTTCTGG - Intronic
1152649365 17:81484739-81484761 CTTCCCAGCCCCGCCCCTTCGGG - Intergenic
1152701446 17:81821852-81821874 CTCCCCTGCTCCTCCTCCCCGGG + Intergenic
1152740302 17:82015780-82015802 CTTCCTGGCTCCCCAGCTTCCGG + Intronic
1154068803 18:11133714-11133736 TCTCCCTGCTCCTCAGCTTGCGG + Intronic
1155555277 18:27011812-27011834 CTTCCCAGTTTCTCCTCTTCAGG + Intronic
1156257826 18:35414841-35414863 CTTCCCTACTCTTCTCCTTCTGG - Intergenic
1156472237 18:37384494-37384516 CTTTCCAGTTCCTCCGCTGCAGG - Intronic
1156973876 18:43192916-43192938 CTTCCTTGCTCCTCAGTTTGCGG - Intergenic
1157273422 18:46293785-46293807 CTTCCCTGGTCCACCTCCTCAGG + Intergenic
1159025642 18:63180281-63180303 CTTCCCTGCTCTTCCCCATTTGG - Intronic
1160071856 18:75635925-75635947 CTTCCCTCCTCCTCGGTTCCAGG - Intergenic
1161868295 19:6850807-6850829 CCTCCCTGCACCTCCGCCTTGGG + Intronic
1161894436 19:7069647-7069669 CCACACTGCACCTCCGCTTCCGG - Exonic
1162592170 19:11599103-11599125 CTTTCCTGGTCCTGGGCTTCAGG + Intronic
1163458209 19:17421051-17421073 CTTCCCTACCCCTCCTCTTCTGG + Intronic
1163711625 19:18850626-18850648 CCTCCCTGCTCCGGGGCTTCAGG + Intronic
1165714662 19:38036588-38036610 TTTCCCTGCTCCACACCTTCCGG + Intronic
1165719665 19:38070083-38070105 CTTCCCTGCTCATCCACGGCAGG + Intronic
1165724636 19:38104237-38104259 TTCCCCTGCTCCTCCGCTGAAGG + Intronic
1166276497 19:41757647-41757669 CTTCTCTGTTCCTCCCCTTGGGG - Intronic
1166749782 19:45159290-45159312 CTTCCCTGCTCCCCCGCCATGGG - Intronic
1166781406 19:45345398-45345420 CTTCCCTGCTCCACCCATCCTGG - Intronic
1168481203 19:56721604-56721626 CTTCCCTGCTTCTCAGTCTCTGG - Intergenic
925105202 2:1285037-1285059 CTTCCTTGCTCCTCAGCTTGGGG - Intronic
925263637 2:2549119-2549141 CTTCCTGGCTCCTCAGCTTGGGG - Intergenic
925302424 2:2826710-2826732 TTGCCCTGCTGCTCCGCCTCTGG + Intergenic
925497927 2:4472985-4473007 CTTCCCTGCTCCTCAGCTTGGGG - Intergenic
927467680 2:23349618-23349640 CTCCCCAGCTCCTCCCCTCCAGG + Intergenic
928441422 2:31295387-31295409 CTTGTCTGCTCGTCTGCTTCTGG - Intergenic
929309473 2:40405772-40405794 CTTCCCTTGTCCTCCTATTCCGG + Intronic
930092328 2:47540160-47540182 CTTCCCTGCTCCACCCTTTGTGG - Intronic
930855709 2:56015768-56015790 CTTCCTTCCTCAGCCGCTTCTGG - Intergenic
932400640 2:71478903-71478925 CTTCCCTCCTCCTCTTCTCCAGG + Intronic
933157882 2:78994222-78994244 CTTCTCTCATCCTCCTCTTCCGG + Intergenic
933748915 2:85590771-85590793 TGTCCCTGCTCCTAGGCTTCTGG + Intronic
935713104 2:105916670-105916692 CTCCACTGCTCCTCTGCTGCGGG + Intergenic
937438907 2:121900670-121900692 CTTCCCTGGTCCCCCGCCCCTGG - Intergenic
938235619 2:129704166-129704188 CCTCCCTCCTTCTCCTCTTCTGG + Intergenic
942452587 2:176117551-176117573 CTTTCCTTCTCCTGCACTTCGGG - Exonic
942732352 2:179074296-179074318 CTTCTTTGCTCCTCAGCTTGCGG + Intergenic
942746593 2:179241256-179241278 CTCCCTTTCTCCTCTGCTTCTGG - Intronic
943718246 2:191175821-191175843 CTTCCCTTCCTCTCCGCATCTGG - Intergenic
945241581 2:207681533-207681555 CCTCCCTGCGCCGCCGCCTCCGG - Intergenic
945377534 2:209096830-209096852 CTTGCCTGCTTCTCTGTTTCTGG - Intergenic
947736777 2:232459304-232459326 CTTCCCTCCGCATCCCCTTCAGG + Exonic
948402271 2:237692504-237692526 CTTACCAGCTTCTGCGCTTCCGG - Exonic
948523392 2:238556406-238556428 CTTCTCTGCTCTTTGGCTTCTGG + Intergenic
1168734079 20:115375-115397 CTGCCCTGCTCCTCCTCACCAGG + Intergenic
1168896758 20:1328987-1329009 CCTCCCTGCCCCTTCCCTTCTGG - Intronic
1168963429 20:1884159-1884181 CTTCCCTGCTCAGCCCTTTCAGG - Intergenic
1169969081 20:11249176-11249198 CTTCCCTGCTGCTCATTTTCAGG + Intergenic
1171372964 20:24673514-24673536 CTTCCCAGCTACTCCGCTGTGGG + Intergenic
1171971423 20:31567308-31567330 TTTCCCTGCCCCTCCCCTTGGGG + Intronic
1172917704 20:38455535-38455557 CCTCCCTGACCCTCAGCTTCTGG + Intergenic
1173583313 20:44162667-44162689 CTTCCTTGCTGCTCAGCTTGTGG + Intronic
1173602832 20:44308203-44308225 AATCCTGGCTCCTCCGCTTCTGG - Intronic
1174038148 20:47680708-47680730 CTTCCCAGCTCCCTCGCCTCTGG - Intronic
1174342730 20:49907951-49907973 CTTCCCAGCTTCTCTGCTTAAGG + Intronic
1174757947 20:53178152-53178174 CTACCCTGCTGTTCCTCTTCTGG + Intronic
1175162677 20:57020736-57020758 CCTCCCAGCTCCTCCCCTGCAGG + Intergenic
1175199451 20:57267473-57267495 CTTCCCACCTCCTCCTCTTCGGG + Intergenic
1175555216 20:59848101-59848123 CTTCCCTCCTCCTTCCCTCCTGG + Intergenic
1175718255 20:61269699-61269721 CTGCTCTCCTCCTCCTCTTCTGG + Intronic
1176116840 20:63435838-63435860 CTTCCCTGCCCCTCCCTCTCCGG + Intronic
1177713576 21:24811247-24811269 TTTCCCTTCTGCTCCACTTCTGG + Intergenic
1177894377 21:26843386-26843408 TTCCCCTGCTCCTCTGCTCCTGG - Intronic
1178011455 21:28291216-28291238 CTTCCTGGCTCCTCAGCTTGTGG - Intergenic
1178100341 21:29261456-29261478 CTTCCCTCCTCCTTCATTTCTGG - Intronic
1179128614 21:38614445-38614467 CTGCCCTGCTCTTCCTCTTAGGG + Intronic
1179164050 21:38921397-38921419 CTCCCCTACTCCTCCACCTCAGG - Intergenic
1179913675 21:44462980-44463002 CTGCCCTGCCCCTCAGCTCCTGG + Intergenic
1181022300 22:20109867-20109889 CTTCCCTGCTCCTCCTAGCCTGG + Intronic
1181660978 22:24348523-24348545 CTGCCCTGCTTCTTGGCTTCTGG + Intronic
1182930654 22:34171007-34171029 TTTCCTTGCTCCTTGGCTTCTGG + Intergenic
1183140654 22:35935467-35935489 TTTCCCTGCTCCTTTCCTTCAGG + Intronic
1183639172 22:39082926-39082948 CTCCCCTGCTCCCCCACTCCCGG + Intronic
1183934911 22:41256587-41256609 TATCCCAGCTCCTCCACTTCGGG - Intronic
1184751327 22:46488109-46488131 CTGCCCTGCACCTCAGTTTCAGG + Intronic
1185237542 22:49723664-49723686 CTGCCCTGCTCTTGCCCTTCAGG + Intergenic
1185368350 22:50447108-50447130 CTGCCCGGCTGCTCTGCTTCCGG - Exonic
950139100 3:10602885-10602907 CCTCCCTCCTCCTCCACTTTTGG + Intronic
950448890 3:13054665-13054687 CTTCTCTGCGCCTCAGCCTCAGG - Intronic
951625759 3:24661731-24661753 CTTCCCTTCTCTTCTCCTTCTGG + Intergenic
952642893 3:35619533-35619555 CTTCCCGGCTCCTCAACTTGTGG + Intergenic
954638376 3:52083935-52083957 CTTCCCTGCTCAACCACTTGAGG - Intronic
954789917 3:53124536-53124558 CTGCCCTGCTCCCCTGCTTAAGG - Intronic
954936137 3:54328792-54328814 CTCCCCTTCTCCTCCCTTTCTGG + Intronic
955663737 3:61328409-61328431 CTTGCCTACTCTTCTGCTTCTGG + Intergenic
961370770 3:126428781-126428803 GTTCCCTCCTCTTCCGTTTCTGG + Intronic
961714970 3:128851902-128851924 CTTGCCTGCTTGTCCCCTTCTGG - Intergenic
961768911 3:129233813-129233835 CTTCTCTTTTCCTCGGCTTCCGG - Intergenic
961920303 3:130418370-130418392 CTTCCCTGCTCCTTTCCTTTCGG + Intronic
962361562 3:134747616-134747638 CTTTTCTGCTTCTCTGCTTCAGG + Intronic
963666036 3:148187533-148187555 CTTCCTGGCTCCTCAGCTTCTGG - Intergenic
964460308 3:156917828-156917850 CTTCCCTTCTCCATCACTTCAGG - Intronic
965813497 3:172614709-172614731 CCTCCCTGCTCCACCCCTTGAGG - Intergenic
966040781 3:175485427-175485449 CTTCCTTGCTCTTCAGCTTACGG - Intronic
966811266 3:183847070-183847092 CTCTCATGCTCATCCGCTTCTGG - Intronic
966828413 3:183984986-183985008 CTTCCCTGCTCCTCCCATCTGGG - Intronic
966885870 3:184377918-184377940 CTGCCCTGCTCCTCCCATTCTGG + Intronic
966983494 3:185159063-185159085 CTTCCCTACGCCTCCGTATCTGG + Intergenic
968801328 4:2744945-2744967 CTTTCCGGCTCCACCTCTTCAGG - Exonic
969350690 4:6596432-6596454 CTTTCCTGCTCCTCGGCGTCTGG - Intronic
969512630 4:7628129-7628151 CTTCCAGGCTCCTGGGCTTCAGG + Intronic
971422909 4:26490362-26490384 CCTCCCTGCTCCTCCACGGCAGG - Exonic
971532397 4:27705302-27705324 TTTCCCTGCTCCTCCGACCCTGG + Intergenic
972584591 4:40425936-40425958 CTTCCCTGCTGCTGCCATTCAGG - Exonic
973175768 4:47203212-47203234 TTTCCCTGCTCTTCCACTTTAGG + Intronic
973279290 4:48341985-48342007 CTTCGCTACTCGTCCGCCTCGGG - Exonic
973808131 4:54545216-54545238 CTGTCCTCCTCCTCTGCTTCCGG - Intergenic
979392668 4:120144836-120144858 CTTCCCTGCCCATTCGCTTTGGG + Intergenic
980821550 4:138023391-138023413 CTCACCTGCTCATCTGCTTCTGG + Intergenic
980923923 4:139115409-139115431 CCTCCCTGCGCCACCGCCTCCGG + Intronic
982155399 4:152515318-152515340 CTTCCCTGCACCCTCGCTTCAGG - Intronic
983459558 4:168011202-168011224 CTTCCCTGTTCTTCAGCTTGCGG + Intergenic
983538047 4:168878419-168878441 CTTCCCTGCCCCTCCGCCTCGGG + Intronic
983558654 4:169079993-169080015 CAGCCCTGCTCCTCTGCTTGTGG - Intergenic
984653315 4:182291757-182291779 GTGCTCTGCTCCTCAGCTTCTGG - Intronic
985601769 5:838787-838809 CTTCCCTGCTCTGCCGCCTGAGG + Intronic
985638593 5:1052609-1052631 CTGCCCTGCTCCTCCCCGCCTGG - Intronic
985755070 5:1708929-1708951 CTTCCCTCCTCCTCCCCTGCGGG - Intergenic
987059301 5:14226763-14226785 CTACCCAGCACCTCCACTTCAGG - Intronic
988533214 5:32043041-32043063 CTTCCCTGCCCTTTGGCTTCTGG + Intronic
988833801 5:35012073-35012095 CCTCCCAGCTTCCCCGCTTCTGG - Intronic
995525551 5:113047936-113047958 CTTCCTTCCTCCTCCTCTGCCGG + Intronic
998846259 5:146313204-146313226 CTTCCCTTTTCCGCTGCTTCAGG + Intronic
1001021033 5:168182797-168182819 GATCCCTGTTCCTCCCCTTCAGG + Intronic
1001988552 5:176096359-176096381 CTTCTCTGCCCCTGCGGTTCTGG + Intronic
1002228316 5:177741774-177741796 CTTCTCTGCCCCTGCGGTTCTGG - Intronic
1002292015 5:178206450-178206472 AGTCCCTGCTGCTTCGCTTCTGG + Intronic
1002338660 5:178499295-178499317 CCTCCCTTCTCCTCCTTTTCAGG - Intronic
1002638199 5:180618392-180618414 CTCTCCTGCTCCTCAGCCTCTGG + Intronic
1003604418 6:7546043-7546065 CTTCCCTGCTCCTCCAATGGAGG - Intronic
1004116042 6:12769048-12769070 CATCCATGCTCCTCAGCCTCTGG - Intronic
1005189540 6:23204583-23204605 CTGCCCTGCTCCTAAGCTGCGGG - Intergenic
1006152677 6:31997758-31997780 CTTCCCTGGCCCTCACCTTCAGG - Exonic
1006158985 6:32030495-32030517 CTTCCCTGGCCCTCACCTTCAGG - Exonic
1007073192 6:39050840-39050862 CTTCCCTGCTCCTGAACTGCTGG - Intronic
1007530567 6:42538260-42538282 TTTCCCTTCTCCTCCTTTTCCGG + Intergenic
1007546023 6:42695345-42695367 CTCCCCTGCCCCTCCTCGTCCGG - Intergenic
1008706353 6:54165284-54165306 CCTCCCTGCACCTCTGCTTATGG + Intronic
1009315168 6:62209962-62209984 CTTCCTTGATCCTCAGCTTGTGG + Intronic
1010351501 6:74880429-74880451 CTTCCATGCTCCTCCATTTTTGG - Intergenic
1010635719 6:78256925-78256947 CTTCCCTGCCCCTCCCCTAGTGG - Intergenic
1013163396 6:107567904-107567926 CTTCCCAGCTCCACCTTTTCTGG + Intronic
1013476101 6:110508670-110508692 CTTGTCTGCTCATCTGCTTCTGG - Intergenic
1013734206 6:113206672-113206694 CTTCCCTCCACCTTCGCTTTAGG - Intergenic
1017107716 6:150903800-150903822 ATTCCCTGCTTTTCAGCTTCTGG - Intronic
1017977543 6:159371452-159371474 CTTCCTTGCTCCTCAGCTTGTGG - Intergenic
1018389869 6:163334034-163334056 CCTCCCTCCTACACCGCTTCCGG - Intergenic
1018486256 6:164243777-164243799 CTTCCTTGCTCCTCAGCTTGCGG + Intergenic
1018563988 6:165132320-165132342 CTTCCTTGCTCCTCAGCTTGCGG - Intergenic
1018569538 6:165194643-165194665 CTTCCCTGCTCCTCAGCTTGCGG + Intergenic
1018741840 6:166735167-166735189 CTGCCCAGCCACTCCGCTTCAGG + Intronic
1018797975 6:167202012-167202034 CTTCCTGGCTCTTCGGCTTCTGG - Intergenic
1018814738 6:167322160-167322182 CTTCCTGGCTCTTCAGCTTCCGG + Intergenic
1018856527 6:167678986-167679008 CTCCCGGGCTCCTCCGGTTCCGG + Intergenic
1018875336 6:167817556-167817578 CTTCCCTCTCCCTCCGCTCCTGG - Intergenic
1018936664 6:168278285-168278307 CATCCCTGCTCCTTCCCCTCTGG + Intergenic
1019045691 6:169143650-169143672 CTCACCTGCTCATCTGCTTCTGG + Intergenic
1019135794 6:169906883-169906905 CTTCCCTGCACATCCTCTGCGGG - Intergenic
1019663997 7:2242239-2242261 CGTACCTGCACCGCCGCTTCCGG - Exonic
1019735499 7:2648085-2648107 TTGCCCTGCCCCTCCGCTTTGGG - Intronic
1020029072 7:4920326-4920348 CGTCCCTGCCCCTCCAGTTCTGG - Exonic
1022079877 7:27009185-27009207 TTTCCTTGCTCCTCAGCTTGCGG + Intergenic
1022801235 7:33779465-33779487 CTTCCCTGCTCTTCCTCGTGGGG - Intergenic
1024614165 7:51094211-51094233 CTCCTCTACTCCTCAGCTTCTGG - Intronic
1024879173 7:54066545-54066567 CTTCCCTGCTTCTCTTCTGCAGG + Intergenic
1027585253 7:80049386-80049408 CTTGTCTGCTCATCCGCTTGTGG + Intergenic
1027840745 7:83308144-83308166 CTTCCCTGCTCCTTAACTTGAGG - Intergenic
1029747189 7:102522648-102522670 CAGCCCTGCTCCTCTGCTTCTGG - Intergenic
1029765142 7:102621737-102621759 CAGCCCTGCTCCTCTGCTTCTGG - Intronic
1031318767 7:120293366-120293388 CTTCTCTTCTCCTTCCCTTCTGG - Intronic
1032084886 7:128878736-128878758 CTTCCCTGCTCCCCAGTCTCAGG - Intronic
1032721859 7:134556493-134556515 CTTACCTGCTTCTCCCTTTCAGG + Intronic
1032839983 7:135705897-135705919 CTTCCTTCCTCCTTCACTTCTGG - Intronic
1033073022 7:138221792-138221814 CTTCCCTTCCCCTACTCTTCTGG - Intergenic
1033167106 7:139049510-139049532 CTTCTGTGCACCTCCTCTTCTGG + Intronic
1035468655 7:159096118-159096140 CCTCCCTGCTGCTCCCCTTAAGG - Intronic
1035559902 8:596447-596469 TCTCCCTGCTCCTCACCTTCAGG - Intergenic
1036652357 8:10653361-10653383 GTTCTCTGCTCCTCTGCTCCTGG - Intronic
1036992324 8:13612204-13612226 CTTTCATGTTCCTCGGCTTCAGG + Intergenic
1037750716 8:21680365-21680387 ATTTCCAGCTCCTCCGCCTCTGG - Intergenic
1037830926 8:22188536-22188558 CTGGCCTGCCCCACCGCTTCCGG - Intronic
1038202437 8:25426321-25426343 TTTCCTTGCTCCTCAGCTTGCGG - Intergenic
1038619818 8:29131166-29131188 CTTCCCTGCTCCCCAACTCCTGG - Intronic
1038647352 8:29372883-29372905 CTTCCCTTCTCCTCCTCCCCGGG - Intergenic
1038713595 8:29972008-29972030 CTGGCCTGCTACTCTGCTTCAGG - Intergenic
1039906040 8:41787107-41787129 CTTCCCAGCTCCTCACCCTCTGG - Intronic
1040536454 8:48315276-48315298 CTCCCTGGCTCCTCTGCTTCAGG + Intergenic
1047432249 8:124803038-124803060 CTTCCCTTCTCCACCTCCTCTGG + Intergenic
1047457113 8:125025100-125025122 CCTTCCTGCTCTTCCCCTTCTGG - Intronic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1048217287 8:132508025-132508047 CTTCGTTGCTCCTCAGCTTGAGG - Intergenic
1049203835 8:141354281-141354303 CTTCCCTGCCCCTCCTCCACCGG - Intergenic
1049222393 8:141434061-141434083 CTGACCTGCTCCTCCTCTTCTGG - Intergenic
1049370957 8:142266778-142266800 TTTCACTGATCCTCCTCTTCCGG + Intronic
1049424623 8:142532606-142532628 CTCCTCTGCTCCTCCCCTGCTGG + Intronic
1049541722 8:143211756-143211778 CTTCCCTGCCCCTCCGCGCGTGG - Intergenic
1049618597 8:143587806-143587828 CTGCCCAGCTCCTCTGCTGCTGG - Intronic
1049645928 8:143735586-143735608 CTTGCCTGCCCCTCCGCCCCAGG - Intergenic
1051128300 9:13830946-13830968 CTTCCCTGCCTCTCTGCTTTTGG - Intergenic
1052769705 9:32676303-32676325 ATTCTCTGCTCCTCCTCTGCAGG - Intergenic
1053576153 9:39358434-39358456 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1053840670 9:42186371-42186393 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG + Intergenic
1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054588626 9:66989807-66989829 CTTCACTGCTCCTCCCCTGCGGG - Intergenic
1055986651 9:82060973-82060995 CTTCACTGCTCCTCCCCTGTGGG - Intergenic
1056227748 9:84512852-84512874 TTTCCCTGATCCTCAACTTCAGG - Intergenic
1056580037 9:87883743-87883765 AGTCCCTGCTCCTCCGCTCAAGG - Intronic
1056584752 9:87920612-87920634 CTTCACTCCTCCTCCCCTGCGGG + Intergenic
1056589458 9:87954067-87954089 CTTCCATTCTCCTCTTCTTCAGG + Intergenic
1056612125 9:88132328-88132350 CTTCACTCCTCCTCCCCTGCGGG - Intergenic
1056852013 9:90092978-90093000 CCTCCCTCCTCCTCTGCTGCTGG - Intergenic
1056900814 9:90597544-90597566 CCTTCCTCCTCCTCCGCTGCGGG - Intergenic
1057160524 9:92885242-92885264 CTTCACTGCTCCTCCCCTGTGGG + Intergenic
1057433288 9:95015630-95015652 CTTCCCTGCACCTCTGATACAGG - Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058953514 9:109925247-109925269 CTTCCCTGCCTCTCTTCTTCAGG + Intronic
1059314194 9:113410314-113410336 CTCCCCTTCGCCTCCGCTTCAGG + Exonic
1060076185 9:120592423-120592445 CTCCCCTGCTTGTCTGCTTCCGG + Intergenic
1060370911 9:123070125-123070147 CTTCCCTACTCCTTCGCCACAGG + Intronic
1061607139 9:131719268-131719290 CTTCCCAACTGCTCAGCTTCTGG + Intronic
1061625478 9:131838555-131838577 CTTCCCCACTCCTCAGCCTCTGG + Intergenic
1061732295 9:132625092-132625114 CTTTCCTGCTCCTTCTCTTAAGG - Intronic
1061738400 9:132679524-132679546 CTTCCTTGCTCCTCTCCTGCAGG - Exonic
1061931972 9:133837999-133838021 CTCTCCTGCTCTTCCCCTTCTGG - Intronic
1062213936 9:135378921-135378943 CTTCACTGCTGCTCGGCTCCTGG - Intergenic
1062299456 9:135856916-135856938 CCTCCCTCCACCTCCTCTTCAGG + Intronic
1062650257 9:137572555-137572577 CTTCCCTGCTGCTACCCATCCGG - Intronic
1187016218 X:15331904-15331926 ATTCCCAGCTCCTCCTCTACAGG + Exonic
1187339115 X:18405632-18405654 CTTCCTTGCCCCTCAGCTTGTGG - Intergenic
1187358537 X:18602056-18602078 CTTCCCTGCTCCTTCCCTGCAGG - Intronic
1187400982 X:18960029-18960051 CTTACCTTCTCCACCTCTTCTGG + Intronic
1187736912 X:22314145-22314167 CCTCCCTCCTCCTCCTCCTCTGG - Intergenic
1187757992 X:22547186-22547208 CTTCCCTGCTGCTAAGGTTCTGG + Intergenic
1188117594 X:26264015-26264037 CTTGCCTGCTCATTTGCTTCTGG + Intergenic
1189418156 X:40832738-40832760 CCGCCATGCTCCTCCGCATCAGG + Intergenic
1190483098 X:50897328-50897350 CTTGTCTGCTCATCTGCTTCTGG + Intergenic
1191864013 X:65689444-65689466 CTTCCCTCCTCATCCACATCCGG - Intronic
1193446820 X:81615824-81615846 CTTCCTTGCTCCTCAGCTTATGG + Intergenic
1194071833 X:89334448-89334470 CTTCCTTGCTCCTCAGCTTGCGG - Intergenic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1196441457 X:115723195-115723217 CTTCCCTGCCCTCCGGCTTCTGG + Intergenic
1196444987 X:115841184-115841206 CTTCCCTGCCCTCCGGCTTCTGG + Intergenic
1196844966 X:119890380-119890402 CTTCCCGGTTCCTCTGCTTTTGG + Intergenic
1197612630 X:128656181-128656203 CTTCCTTGGTCCTCTGCTTCTGG - Intergenic
1200049786 X:153422600-153422622 CTTACCTGCTCCTCCCCATCAGG + Intergenic
1200250073 X:154547940-154547962 CCTCCCTCCTCCTCCACTGCGGG + Intronic
1200726079 Y:6670176-6670198 CTTCCTTGCTCCTCAGCTTGCGG - Intergenic
1201307521 Y:12563531-12563553 CTTCGCTGCCCCTACTCTTCTGG + Intergenic