ID: 1112332442

View in Genome Browser
Species Human (GRCh38)
Location 13:98486699-98486721
Sequence GTAGTTCAGCGGTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112332442_1112332447 9 Left 1112332442 13:98486699-98486721 CCAACAGAGAACCGCTGAACTAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112332442 Original CRISPR GTAGTTCAGCGGTTCTCTGT TGG (reversed) Intronic
900957645 1:5897098-5897120 GTAGTTCATCGCTTATCGGTAGG + Intronic
903710904 1:25323412-25323434 GTAGTTCAGTGGTTGCCTTTGGG - Intronic
903716043 1:25368017-25368039 GTAGTTCAGTGGTTGCCTTTGGG + Intronic
904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG + Intergenic
914375178 1:147066751-147066773 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
915652435 1:157325875-157325897 GGAGTTCAGGGATTCTCTGGAGG - Intergenic
919254899 1:195108490-195108512 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
923281522 1:232447524-232447546 GAAGTTCAGCCATTCTCTGTCGG - Intronic
1066344998 10:34575929-34575951 GTATTTGAGCTCTTCTCTGTAGG + Intronic
1066784913 10:38992907-38992929 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1066992510 10:42529505-42529527 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1077372269 11:2188667-2188689 GTGTTTTAGGGGTTCTCTGTGGG - Intergenic
1083584030 11:63843544-63843566 GTAGTTCAGCTGTTCCTTATAGG - Intronic
1083792488 11:64994897-64994919 GTAGTGCAGCGGCTCTATCTTGG + Intronic
1083843188 11:65315974-65315996 GGGGTTCAGCGGGTCACTGTAGG - Intronic
1083901020 11:65643563-65643585 GTGTTTCAGCAGTTCTCTGTGGG - Intronic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG + Intronic
1093332347 12:17858250-17858272 GTAGTTCAGCGGCTTTGAGTGGG - Intergenic
1093604457 12:21073501-21073523 TTAGTTCACCGGTTTTGTGTGGG + Intronic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1110993892 13:82079781-82079803 GGAGTTCAGCAGTCTTCTGTAGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1118698538 14:68410203-68410225 GTAGTTCAGTGGTTCTTGGCTGG - Intronic
1121412726 14:93759193-93759215 GTTGCTCAGCGGGTCTCTATTGG + Intronic
1132966670 16:2659831-2659853 GTAGTGCTGCAGTTCTGTGTGGG - Intergenic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1147059852 17:37866729-37866751 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1148409119 17:47449220-47449242 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1153237131 18:2999160-2999182 GGAGTTCAGCGTTTCTTTTTTGG - Intronic
1154463548 18:14620403-14620425 GTAGGCCAGTGGTTCTCTGGGGG - Intergenic
1155951932 18:31922964-31922986 GGAGTTCAGTGGCTCTCTCTTGG - Intronic
1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG + Intronic
1168672624 19:58252573-58252595 GTAGTTCAGAGGTTGTCTAAAGG - Intronic
929275933 2:40024670-40024692 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
932103318 2:68920781-68920803 GTAGTTCAGCCTGTCTCTTTTGG + Intergenic
936782606 2:116052238-116052260 GTAGTTGAGCGGCTTTGTGTGGG + Intergenic
937494495 2:122403312-122403334 TTACTCCAGCGGTTCTCAGTGGG - Intergenic
939137019 2:138308856-138308878 GTAGGACAGTGGTTCTCAGTTGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG + Intergenic
942132710 2:172896803-172896825 GTTGTTCATCAGTTCACTGTTGG + Intronic
942586027 2:177479050-177479072 GTGGTTCAGAGATTCTCTCTGGG - Intronic
947326315 2:228982152-228982174 ATAGTTTAGTGGTTCTCTCTGGG - Intronic
1173766983 20:45620539-45620561 GGAGTACAGCGGTGCTCTCTTGG - Intronic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1176810976 21:13537969-13537991 GTAGGCCAGTGGTTCTCTGGGGG + Intergenic
1179046447 21:37849305-37849327 GTGGTTCAGCGTCTCTCTGGGGG + Intronic
1180256616 21:46634286-46634308 GTAGATCAGGGATTCTCTGGAGG + Intergenic
1181320765 22:22004334-22004356 GTAGTTCAGTGCTCCACTGTGGG - Intergenic
1183888619 22:40906490-40906512 GTAGGTCAGTGATTCTCAGTGGG + Intronic
955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG + Intergenic
957129024 3:76199477-76199499 GTAGGTCAGAGGTTCTATATGGG - Intronic
963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG + Intergenic
963976099 3:151481769-151481791 TTAGTTGAGGGGATCTCTGTTGG - Intergenic
973857850 4:55031358-55031380 GAAGAACAGCTGTTCTCTGTTGG - Intergenic
983582233 4:169320532-169320554 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
988771735 5:34439499-34439521 GTAGTCCAGCCTTTCTCTTTGGG - Intergenic
992514505 5:77477519-77477541 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
994333824 5:98540415-98540437 GTAGAGCAGCTGTGCTCTGTTGG + Intergenic
997094982 5:130900376-130900398 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG + Intergenic
998362835 5:141604750-141604772 TTAGTTAAGCGGTTGTCAGTAGG - Intronic
998553128 5:143096854-143096876 TTAGGACAGTGGTTCTCTGTTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1005045599 6:21639363-21639385 GTAGTTCAACAGCTCTCTGCTGG - Intergenic
1006952585 6:37836132-37836154 TTAGATCAGTGATTCTCTGTGGG + Intronic
1007845346 6:44750270-44750292 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009617735 6:66032179-66032201 GGTGCTCAGAGGTTCTCTGTTGG - Intergenic
1010082929 6:71885738-71885760 GTAGTTCAGAGTATCTCTGTAGG - Intergenic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1012914283 6:105151857-105151879 GTGGTTCAGAGCTTCACTGTAGG - Intergenic
1014131456 6:117838907-117838929 GTAAGTCAGTGGTTCTCAGTGGG - Intergenic
1014685998 6:124501171-124501193 GAGGTGCAGTGGTTCTCTGTGGG - Intronic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG + Intergenic
1020694425 7:11395987-11396009 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
1030127214 7:106165615-106165637 GCAGTTCTGCTGGTCTCTGTTGG - Intergenic
1036384130 8:8263111-8263133 ATGGGGCAGCGGTTCTCTGTTGG - Intergenic
1037545193 8:19913290-19913312 GTAGTTGAGCGGTTTTGAGTGGG + Intronic
1038678170 8:29642519-29642541 TTAGTTCAGCTGGTCTCTGTGGG - Intergenic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1055467044 9:76576259-76576281 GTAGTTTTGAGGTTCTTTGTTGG - Intergenic
1061247693 9:129409385-129409407 TTAGTTCAGAGGGTCTCTGGGGG - Intergenic
1061744027 9:132726738-132726760 GTACTACAGCCGTTCACTGTTGG + Intronic
1185599135 X:1327005-1327027 GGAGTGCAGCGGCTCTATGTAGG - Intergenic
1186019539 X:5238538-5238560 GTAGATCCGTGGATCTCTGTAGG - Intergenic
1187885616 X:23886165-23886187 GTAAATCAGAGGTTCTCAGTGGG - Intronic
1193707715 X:84843355-84843377 TTAGTCCAGCAGTTCTCAGTGGG + Intergenic
1198109663 X:133491873-133491895 TTAGTTCAGCTGTTCACTTTTGG + Intergenic
1198524215 X:137484004-137484026 TTAGTTCTGAGGTTCACTGTAGG + Intergenic
1200889569 Y:8308990-8309012 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic