ID: 1112332447

View in Genome Browser
Species Human (GRCh38)
Location 13:98486731-98486753
Sequence GGACGCTGACAAATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112332443_1112332447 -2 Left 1112332443 13:98486710-98486732 CCGCTGAACTACACCCACGATGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332441_1112332447 10 Left 1112332441 13:98486698-98486720 CCCAACAGAGAACCGCTGAACTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332439_1112332447 27 Left 1112332439 13:98486681-98486703 CCCAGAGGGCAAAATCACCCAAC 0: 1
1: 0
2: 4
3: 35
4: 216
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332437_1112332447 29 Left 1112332437 13:98486679-98486701 CCCCCAGAGGGCAAAATCACCCA 0: 1
1: 0
2: 7
3: 43
4: 294
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332438_1112332447 28 Left 1112332438 13:98486680-98486702 CCCCAGAGGGCAAAATCACCCAA 0: 1
1: 1
2: 1
3: 27
4: 288
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332442_1112332447 9 Left 1112332442 13:98486699-98486721 CCAACAGAGAACCGCTGAACTAC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134
1112332440_1112332447 26 Left 1112332440 13:98486682-98486704 CCAGAGGGCAAAATCACCCAACA 0: 1
1: 0
2: 2
3: 19
4: 222
Right 1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112332447 Original CRISPR GGACGCTGACAAATCTGACA TGG Intronic
902630812 1:17703295-17703317 GGAAGCAGACAGAACTGACAGGG - Intergenic
904224553 1:29005202-29005224 GGAAGCTGGCACATCTTACATGG + Intronic
908073083 1:60485251-60485273 GGACACTGATGACTCTGACAGGG + Intergenic
908150676 1:61298256-61298278 GGAAGCAGACACATCTTACACGG - Intronic
910619890 1:89241985-89242007 GGAAGCTGGCACATCTTACAAGG - Intergenic
912810103 1:112787617-112787639 GGAAGCAGACACATCTTACATGG + Intergenic
916152630 1:161810291-161810313 GGAAGCTGGCACATCTTACATGG + Intronic
919252840 1:195081660-195081682 GGAAGCAGACACATCTAACATGG + Intergenic
919876094 1:201869776-201869798 CTATGCTGAGAAATCTGACATGG + Intronic
922357160 1:224787187-224787209 GGAAGCAGACACATCTTACATGG - Intergenic
924122087 1:240810983-240811005 GGACGCTGACACATGTCGCATGG - Intronic
1065828678 10:29595267-29595289 GGAAGCTGAGAAATGAGACAAGG + Intronic
1067288576 10:44924925-44924947 GGACACTGGCAAAGCTGCCAGGG + Intronic
1069224315 10:65922899-65922921 GGAAGCAGACACATCTTACATGG + Intronic
1071032262 10:81198419-81198441 GGAAGCAGACACATCTTACATGG - Intergenic
1071910047 10:90221347-90221369 GGAGGCAGACACATCTTACATGG + Intergenic
1073049696 10:100659705-100659727 GAACATTGACAAATTTGACAAGG - Intergenic
1073906354 10:108285202-108285224 GGAAGCAGACACATCTTACATGG - Intergenic
1077090033 11:774175-774197 GGAGCCTGAAAAAGCTGACAAGG + Intronic
1078320726 11:10332368-10332390 GGAAGCAGTCACATCTGACATGG + Intronic
1081090089 11:38853787-38853809 GGAAGCTGGCAAGTCTGACATGG - Intergenic
1081623664 11:44634207-44634229 GGACACAGCCAAATCTGACAGGG - Intergenic
1084692479 11:70735130-70735152 GGACTCTGCCCAATCTGTCAGGG + Intronic
1085601094 11:77856651-77856673 GGAAGCTGGCACATCTTACATGG + Intronic
1086766595 11:90703343-90703365 GGAAGCAGACATATCTTACATGG - Intergenic
1091646116 12:2273724-2273746 AGACGCTTGCAAATCTGAAAGGG + Intronic
1091790252 12:3268079-3268101 GGAGGCTGACAAACCAGTCATGG - Intronic
1096150379 12:49306463-49306485 GAATGCTAACAACTCTGACAGGG - Intergenic
1098130798 12:67347961-67347983 GGAAGCAGACACATCTTACATGG + Intergenic
1099724658 12:86410962-86410984 GGATGCTGACACATCTTACATGG - Intronic
1100910099 12:99350196-99350218 GGACGCAGGCACATCTTACAGGG - Intronic
1107760329 13:43671154-43671176 GGAAGCAGACATATCTTACATGG - Intronic
1107764606 13:43720877-43720899 GGACACTGACAACCCTGAGAGGG + Intronic
1109199996 13:59419763-59419785 GGAAGCAGACACATCTTACATGG + Intergenic
1109512881 13:63402758-63402780 GGACGCAGGCACATCTTACATGG + Intergenic
1111791412 13:92860560-92860582 GGATTCTAACAAATCTGAGATGG - Intronic
1112332447 13:98486731-98486753 GGACGCTGACAAATCTGACATGG + Intronic
1112827936 13:103413651-103413673 GGACGCAGGCACATCTTACATGG - Intergenic
1114598727 14:23936313-23936335 GGATCCCCACAAATCTGACAAGG + Intergenic
1115372519 14:32633911-32633933 GGAAGCTTACAAATCTTCCATGG + Intronic
1117117486 14:52531161-52531183 GAACACTGACAACACTGACAAGG + Intronic
1118286389 14:64477834-64477856 GGATGCACATAAATCTGACACGG + Intronic
1121107095 14:91288023-91288045 CCACGGTGACAAAACTGACATGG + Intronic
1122457513 14:101865742-101865764 GGACACTGACAACTTTGTCACGG - Intronic
1124077635 15:26461345-26461367 GGAAGCAGACACATCTTACATGG - Intergenic
1126026108 15:44447868-44447890 GGGCGCAGTCAAAGCTGACATGG + Intronic
1130579898 15:85126788-85126810 TGACTATGACACATCTGACATGG - Intronic
1131427179 15:92355110-92355132 GGAAGCAGACACATCTTACAAGG - Intergenic
1140680074 16:77376199-77376221 GGCCGCAGACACATCTTACATGG + Intronic
1151100566 17:71551178-71551200 GTACCCTGCCAAGTCTGACATGG + Intergenic
1153630136 18:7061680-7061702 GTAGGCTCACAAATCTGTCATGG + Intronic
1153932231 18:9887994-9888016 GGACGCTGACAACTGTGAGGAGG + Exonic
1155834298 18:30559582-30559604 GGACGCAGGCACATCTTACATGG + Intergenic
1156250870 18:35351571-35351593 GGAAGCTGGCACATCTTACATGG - Intergenic
1158189909 18:54815357-54815379 GAAAGCTGAGAAGTCTGACATGG - Intronic
1163251725 19:16129795-16129817 GGACGCTGCCCAAGCAGACAAGG + Intronic
1167272411 19:48513444-48513466 GGACACCGACACATCAGACAAGG + Intergenic
925644389 2:6021015-6021037 GGAAGCTGCCACATCTTACATGG - Intergenic
929175895 2:38975897-38975919 GGACTCTGAAAAATATGAGATGG - Intergenic
930846401 2:55909583-55909605 GGACATTGGGAAATCTGACAAGG - Intronic
931240679 2:60449734-60449756 AGAGGCTCACAAATCTGCCAGGG - Intergenic
932111194 2:69002595-69002617 GGAAGCAGACACATCTTACATGG + Intergenic
932463734 2:71899602-71899624 GGAAGCACACAAATCTTACATGG - Intergenic
934780571 2:96967151-96967173 GGAAGATGAAAAATCTCACATGG + Intronic
934886276 2:98028342-98028364 GGATGCTGCCAAATCTCAGAGGG - Intergenic
935096764 2:99952275-99952297 GGAAGCTGACATGTCTTACATGG - Intronic
937756862 2:125550199-125550221 GGAAGCTGACACATTTGACATGG + Intergenic
939969122 2:148640651-148640673 TGAAGCTAACAAATCTGACTTGG - Intergenic
941572140 2:167184186-167184208 GGAGGCTGAGAAATCTGTCTTGG - Intronic
1174981587 20:55401508-55401530 GGAAGCTGGCACATCTTACATGG - Intergenic
1175007571 20:55701650-55701672 GGAAGCAGACACATCTTACATGG + Intergenic
949386627 3:3509806-3509828 GGATGCTGGCAAATCTGTCACGG + Intergenic
949749952 3:7340374-7340396 GGAAGCAGACACATCTTACATGG + Intronic
953471199 3:43168337-43168359 GGAAGCAGACATATCTTACATGG - Intergenic
960184510 3:114622549-114622571 GGCCACTGACAAACCTGATAAGG + Intronic
961999447 3:131279953-131279975 AAAAGCTGACAAGTCTGACAGGG - Intronic
964367611 3:155966588-155966610 GGAAGCTGGCACATCTTACACGG - Intergenic
966569001 3:181419102-181419124 GGTGGCTGACAAATCTCAGAAGG + Intergenic
969209759 4:5677782-5677804 GGACACAGGCAAATCCGACATGG + Intronic
970079908 4:12270685-12270707 GGAAGCTGATTTATCTGACAAGG - Intergenic
971356406 4:25898948-25898970 GGAAGCAGGCAAATCTTACATGG - Intronic
974989605 4:69069258-69069280 GATAGCAGACAAATCTGACAAGG - Intronic
975213593 4:71729077-71729099 GGACGCTGGCCAATAGGACATGG - Intergenic
975694291 4:76996457-76996479 GGAGGCTGTCAAATCCCACATGG - Exonic
976442924 4:85096934-85096956 GGAAGATGAGAAATCTCACAGGG + Intergenic
979420873 4:120503489-120503511 GGAAGCTGGCACATCTTACAAGG + Intergenic
981275300 4:142892534-142892556 GGAAGCAGACACATCTTACATGG - Intergenic
981531768 4:145761061-145761083 GGAGGCAGACATAACTGACAGGG + Exonic
982510918 4:156282247-156282269 TGACGCAGTCAAATCTGACTTGG - Intergenic
982666527 4:158271069-158271091 GGAAGCAGACCCATCTGACATGG - Intergenic
983737597 4:171082411-171082433 GGAGGCAGACATATCTTACATGG - Intergenic
984159729 4:176237258-176237280 GGACACTGACAGATTTGAAATGG + Intronic
984913850 4:184702101-184702123 AGATGTTGACAAATCTGAAAAGG - Exonic
985530979 5:433737-433759 GGACGATGCTAAATCTGCCAAGG - Intronic
988297466 5:29384082-29384104 GGAAGCTGGCACATCTTACATGG - Intergenic
993331675 5:86607880-86607902 GGAAGCAGACACATCTTACATGG + Intergenic
995237261 5:109843248-109843270 GGAAGCAGACAAGTCTTACATGG + Intronic
996356267 5:122599596-122599618 GGAAGCAGACACATCTTACATGG + Intergenic
996674582 5:126159209-126159231 GGAAGCAGACACATCTTACATGG + Intergenic
997273631 5:132563931-132563953 GGAGGCTGGCACATCTTACACGG - Intronic
997273775 5:132565151-132565173 GGATGCTGGCACATCTTACATGG - Intronic
998036365 5:138920414-138920436 GGACACTGGCAAATGTGGCAGGG - Intronic
999808758 5:155108411-155108433 GGAAGCAGACATATCTTACATGG - Intergenic
1001944611 5:175768330-175768352 GGAAGCAGACACATCTTACATGG + Intergenic
1002221980 5:177690332-177690354 GGACTCTGTCTAATCTGTCATGG + Intergenic
1004201157 6:13549255-13549277 GGAAGCAGGCACATCTGACATGG - Intergenic
1004795921 6:19084571-19084593 GGATCATGATAAATCTGACATGG + Intergenic
1005189736 6:23207080-23207102 GGAAGCAGACACATCTTACATGG - Intergenic
1006185589 6:32179961-32179983 GGAAGCCGGCAAATCTGTCAAGG - Intronic
1008366072 6:50682117-50682139 GGTCGTTGGCAAATTTGACAAGG - Intergenic
1010390762 6:75334471-75334493 GAGCCCTGACTAATCTGACAAGG - Intronic
1014963858 6:127722195-127722217 AGAAGCTGGAAAATCTGACAGGG - Intronic
1016455922 6:144230693-144230715 GGAAGCAGGCACATCTGACATGG + Intergenic
1018566408 6:165159187-165159209 GCAGCCTGAAAAATCTGACATGG - Intergenic
1018575624 6:165257811-165257833 GGAAGCAGACAAGTCTTACATGG + Intergenic
1019936407 7:4261151-4261173 GGAGGCTGACCACTCTCACAGGG + Intronic
1020518596 7:9157511-9157533 GGAAGTTGGCAAATCTCACAAGG - Intergenic
1022218686 7:28290680-28290702 GGAAGCTGGCAAGTCTTACATGG - Intergenic
1027463210 7:78481276-78481298 GGAAGCAGACACATCTTACATGG + Intronic
1031483527 7:122304434-122304456 GGACGCTGGCGACTCAGACATGG - Exonic
1032712810 7:134475988-134476010 GGAGGCAGGCAAGTCTGACATGG - Intergenic
1034489677 7:151386566-151386588 GAACCCTGCCAAAGCTGACACGG - Intronic
1034611113 7:152369768-152369790 GGAGGCTGAGAAATCTAAGATGG - Intronic
1036117254 8:5971878-5971900 GGACGCCTTCAAATCTGAAAAGG - Intergenic
1037044057 8:14275545-14275567 AAACCCTGACACATCTGACATGG - Intronic
1037087013 8:14865045-14865067 GTACACACACAAATCTGACAAGG - Intronic
1037148751 8:15608724-15608746 GGAAGCTGGCACATCTTACATGG - Intronic
1041875192 8:62679637-62679659 GGAAGCAGACACATCTTACATGG + Intronic
1046353626 8:113048739-113048761 GAACACTGACAAATCTACCATGG - Intronic
1052458256 9:28728874-28728896 GGACGCTGAGAAACCTAAGAAGG + Intergenic
1053327535 9:37168826-37168848 GGACACAGCCAAATCTGACAGGG + Intronic
1055088364 9:72337381-72337403 GGATGATGACAACTTTGACAAGG - Intergenic
1056798685 9:89676439-89676461 GGACTATGGCAGATCTGACACGG - Intergenic
1061106913 9:128538047-128538069 GGTGGCTGTCACATCTGACAAGG - Exonic
1186278107 X:7962200-7962222 GGAAGCTGACAGTTCTCACATGG + Intergenic
1186373504 X:8970979-8971001 GGAAGCTGGCACATCTTACACGG - Intergenic
1187345525 X:18460230-18460252 GGAAGCTGGCAAGTCTTACATGG + Intronic
1189284169 X:39840016-39840038 GGACCCTGATAAATCTGTCCTGG + Intergenic
1189584073 X:42439569-42439591 GAACTTTGACAAAGCTGACAAGG + Intergenic
1193509011 X:82377097-82377119 GGAAGCTGGCATATCTTACATGG + Intergenic
1193549809 X:82877972-82877994 GGAAGCTGACATGTCTTACATGG - Intergenic