ID: 1112332696

View in Genome Browser
Species Human (GRCh38)
Location 13:98488897-98488919
Sequence GAGGCTGCCAAGGGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112332696_1112332701 3 Left 1112332696 13:98488897-98488919 CCTGAAATGCCCTTGGCAGCCTC 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1112332701 13:98488923-98488945 ATTTCACCAGCTGTAACCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 171
1112332696_1112332703 17 Left 1112332696 13:98488897-98488919 CCTGAAATGCCCTTGGCAGCCTC 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1112332703 13:98488937-98488959 AACCAAAGGCCAAGACCAAGAGG 0: 1
1: 1
2: 1
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112332696 Original CRISPR GAGGCTGCCAAGGGCATTTC AGG (reversed) Intronic
900686762 1:3953797-3953819 CGGGCTTCCAGGGGCATTTCGGG - Intergenic
900788597 1:4665341-4665363 CAGGCTTCCAGGGGCATTTTGGG + Intronic
901212424 1:7534119-7534141 GAGGCTGCCAGGGGCCTGGCGGG - Intronic
901668279 1:10838709-10838731 GAGGCTGCAGAGGGCGTTTGTGG + Intergenic
901680436 1:10909905-10909927 GAGGCTTGCAAGGACATGTCAGG + Intergenic
902206702 1:14873585-14873607 GAGGGAGCCAGGGGCCTTTCAGG + Intronic
902673745 1:17993991-17994013 AAGGCTGCCACTGCCATTTCAGG + Intergenic
903857282 1:26344700-26344722 GAGGCTGTCCAGGGTATTGCAGG - Exonic
903953897 1:27012116-27012138 GAGGATGTCAAGGGCATTGGGGG - Intronic
904189140 1:28729987-28730009 GAAGATGGCAAGGCCATTTCAGG + Intergenic
906527523 1:46503916-46503938 GAGGCTGCCAAGGTCCCATCCGG - Intergenic
907035582 1:51213227-51213249 CAGGCTCCCAAGGGGATTACAGG - Intergenic
907274596 1:53310234-53310256 GAGGGGCCCAAGGGCTTTTCTGG - Intronic
907730660 1:57062309-57062331 GAGGCTGGCCAGGGCCTTTGGGG - Intronic
911053263 1:93689981-93690003 GATGCTGCCATGAGCATTTTAGG - Intronic
911516366 1:98872704-98872726 GAGGCTGCCAAGTAGATTTTAGG + Intergenic
916287835 1:163130531-163130553 TAGTCTGACAAGTGCATTTCTGG + Intronic
918292922 1:183126324-183126346 GAGGCTGTCAAAGTCCTTTCTGG - Intronic
920491794 1:206421545-206421567 AAGGATGCCATGGGCAGTTCTGG - Intronic
920683338 1:208090079-208090101 GAGGTTGCCAGGGCCACTTCCGG - Intronic
920811541 1:209290420-209290442 GAGGCTAGAAAGGGCATTCCTGG - Intergenic
923192249 1:231630538-231630560 GTGGCTGCCAAGGGAATCTCTGG - Intronic
1065535536 10:26711692-26711714 GGGGCTGCCATGTGCATTACAGG + Intronic
1066425295 10:35302669-35302691 CAGGCACCCAAGGGCATCTCAGG + Intronic
1069551156 10:69365347-69365369 GAGGTCGCCAAGGGCATCCCTGG - Intronic
1070050438 10:72883631-72883653 AATGCTGCCAAAAGCATTTCTGG - Intronic
1070144675 10:73765151-73765173 GGGGCTGCCATGGGCATATGAGG - Intronic
1070337333 10:75467221-75467243 GAGGCTGAGGAGGACATTTCAGG + Intronic
1070575842 10:77678173-77678195 GAGGCTGACAAAGGCAGGTCAGG + Intergenic
1071093425 10:81946484-81946506 GAGGCTGCCAAGAGCCTTCCGGG - Intronic
1071965692 10:90850057-90850079 GAGACTGCCAAGTGCTCTTCTGG - Intronic
1073026524 10:100490813-100490835 GAAGGTGCCAAGGGCATCGCTGG + Exonic
1073176973 10:101562551-101562573 GAGGCTGCCATGGGGATATAGGG + Intergenic
1074884686 10:117684762-117684784 GAGTCTGCCGAGCCCATTTCAGG - Intergenic
1077530223 11:3091506-3091528 GAGGCTGCAGAGGGCATTGGGGG + Intronic
1079770740 11:24455411-24455433 ATGGTTGCCAAGGGCTTTTCAGG - Intergenic
1080067378 11:28033702-28033724 GAGGCTGGGAAGGGTTTTTCGGG + Intronic
1080570495 11:33552172-33552194 GAGGCTGCAGAAGGCATTCCAGG + Exonic
1081754798 11:45536897-45536919 GAGGCTGCCAAAGCCCTTTCAGG - Intergenic
1084042298 11:66549231-66549253 AGGGCAGGCAAGGGCATTTCAGG - Intronic
1086334613 11:85787559-85787581 GAAGATGACAAGGGCATTTGTGG + Intronic
1086894385 11:92295289-92295311 GAGCCTGCCAAGAGCACTTATGG + Intergenic
1088218980 11:107547154-107547176 GAAGCTGCCATAGGCATTACAGG + Intronic
1089161997 11:116445479-116445501 GAGGCTGCCAAGGACTCATCAGG + Intergenic
1090635011 11:128685627-128685649 GAGGCGGCGAAGGGAATCTCTGG + Intergenic
1091653026 12:2323779-2323801 GAGGCTGCGTAGGGCATTGTGGG + Intronic
1091786315 12:3245260-3245282 GAAGGTGCCAAGCCCATTTCTGG + Intronic
1092272818 12:7037092-7037114 GAGGCTGGTGAGGGCATTTGAGG + Intronic
1095401663 12:41821151-41821173 AAGGCTGCCATGGGCATATATGG + Intergenic
1096120507 12:49086263-49086285 GAGACTGGAAAGGGCATTCCAGG - Intergenic
1098949247 12:76622683-76622705 CAGGCTGTCAAGGGCCTATCTGG - Intergenic
1100995874 12:100300643-100300665 GAGGCTGGGAAGGGCAGTTGAGG - Intronic
1101867525 12:108531910-108531932 GAAGCTGCTACTGGCATTTCAGG + Intronic
1103800023 12:123532237-123532259 GGGGCTGCCAAGAGCATCCCTGG + Intronic
1103952099 12:124556955-124556977 GAAGCTGCCTGGTGCATTTCAGG + Intronic
1103963393 12:124623129-124623151 GAGGCTGCCCTTGGCATTCCAGG - Intergenic
1103994649 12:124821290-124821312 GAGGCTGCAAAGGGAAATTGAGG - Intronic
1104784674 12:131441855-131441877 GAGGCTGCCCAGTGCTGTTCAGG - Intergenic
1105954254 13:25265160-25265182 GAGAGAACCAAGGGCATTTCAGG - Intronic
1106038660 13:26068964-26068986 GTGGCTCCCAAGGTCATTTTAGG + Intergenic
1107719372 13:43231599-43231621 GAAGTTGTTAAGGGCATTTCAGG - Intronic
1107720545 13:43243839-43243861 GAGCTTTCCAAGAGCATTTCTGG - Intronic
1108641444 13:52386054-52386076 GAGGCCTCCAAGGACATTCCAGG + Exonic
1110124219 13:71922025-71922047 GAGGCTGTCATGGGCATTGTAGG + Intergenic
1112051795 13:95649986-95650008 GAGGCTGCCATGCCCATTTCAGG - Intergenic
1112332696 13:98488897-98488919 GAGGCTGCCAAGGGCATTTCAGG - Intronic
1116560972 14:46377702-46377724 GAGGATCCCAAGAACATTTCAGG + Intergenic
1116948075 14:50854688-50854710 GAGGTGGCCATGGGCATTTGGGG + Intergenic
1117753305 14:58946065-58946087 AAGGCTGCAAAAGGCATTCCTGG - Intergenic
1120160691 14:81141807-81141829 GAGGCAGCCATGGGTTTTTCAGG + Intronic
1121920818 14:97879370-97879392 GAAGGGGCCAAGGCCATTTCTGG + Intergenic
1123948263 15:25249368-25249390 GAGGCCCCAAAGGGCATCTCAGG + Intergenic
1124802995 15:32853005-32853027 CAGGCTACAAAGGGCATTCCAGG - Intronic
1125267188 15:37896612-37896634 ATGGCTGGCAAGGTCATTTCTGG - Intergenic
1126492042 15:49247701-49247723 GAGGGGCCCAAGGGCATTTCAGG + Intronic
1128533554 15:68471874-68471896 GAGACTGCTGAGGACATTTCAGG + Intergenic
1128890708 15:71329477-71329499 GAGGCAGCAAAGGACGTTTCAGG - Intronic
1130183328 15:81652661-81652683 GAGCCTGCCATGGGCAAGTCAGG - Intergenic
1132380205 15:101360845-101360867 CAGGGTGACAAGGGCATTTCAGG - Intronic
1134282465 16:12829898-12829920 GGGGCTGCCATGGGCATTATAGG - Intergenic
1136102042 16:28003694-28003716 AAGGCTGCCAGGGGGAATTCTGG - Intronic
1139658963 16:68407205-68407227 TAGGTTGCTAAGGGCATTTAGGG + Intronic
1139748720 16:69095429-69095451 GAGACTTACAAGTGCATTTCTGG - Intergenic
1140871441 16:79110319-79110341 GAGGTTGGCAGGGGCATGTCGGG - Intronic
1141598760 16:85112785-85112807 GAGCCTGCCACTGGCCTTTCTGG + Intergenic
1143151268 17:4808618-4808640 GAGGCTGCCAAGAGCATTTTGGG - Intronic
1146466748 17:33092252-33092274 AAGGAAGCCAAGGGCAATTCTGG - Intronic
1146514360 17:33477875-33477897 GAGGCAGCTCAGGGCATTTGAGG + Intronic
1146551483 17:33783938-33783960 GTTCCTGCCAAGGGCATCTCTGG - Intronic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1147310731 17:39594888-39594910 GAGGCAGCCAAGAGGTTTTCTGG + Intergenic
1147333521 17:39713002-39713024 GAGGCACACAAGGACATTTCTGG + Intronic
1149627494 17:58090129-58090151 TTGGCTGGCAAGGGAATTTCTGG + Exonic
1150217991 17:63480872-63480894 GATGCTGCCACTGTCATTTCTGG - Intergenic
1152508627 17:80770439-80770461 GAAGGTGCCCAGGGCATTTGGGG + Intronic
1153970071 18:10217978-10218000 AGGGCTGACCAGGGCATTTCAGG - Intergenic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1156528693 18:37794432-37794454 GAGGCTGCCCAGGGCCAGTCTGG + Intergenic
1156890325 18:42183525-42183547 GAGCATGCCAAGGGTATTTGTGG - Intergenic
1157636319 18:49158747-49158769 GAGGCTGCGAAGGGTAGTTGGGG + Intronic
1160125707 18:76169586-76169608 GATGCAGCCAAGGGGATTCCAGG + Intergenic
1161237054 19:3203544-3203566 GAGGCTGTCCTGGGCACTTCAGG - Intronic
1165240430 19:34462479-34462501 AAGAATGCCAAGGGCATTCCTGG + Intronic
1165454903 19:35904699-35904721 GAAGCTGCCAGGGGCCTTGCAGG - Intronic
1165816981 19:38648301-38648323 GAGGCTGAGAAGGGAATTTCTGG + Intronic
1166017483 19:39993819-39993841 GAGGCTGCACAGGTCAATTCTGG - Intronic
1168297060 19:55382545-55382567 GAGACAGCCAAGGGCACTCCTGG + Intronic
925311846 2:2890418-2890440 GAGGCTGGCATGGGTATTGCAGG - Intergenic
926331900 2:11832510-11832532 GTGGATGTCAAGGGCATCTCCGG - Intergenic
926334069 2:11850144-11850166 GAGCCTTCCAGGGGCCTTTCAGG - Intergenic
928938663 2:36705867-36705889 GAGGCTGTCCTGGGCATTGCAGG + Intronic
929059958 2:37913972-37913994 GTGGCTGCCCAGGGCATGCCGGG + Intergenic
929318087 2:40505190-40505212 GAGGCTGGCAAGGGTAGTTAGGG + Intronic
930013395 2:46955012-46955034 GAGGCAGAGAAGGACATTTCAGG - Intronic
932708263 2:74043603-74043625 GAGGCTGAGAAGGGCATTCCAGG + Intronic
933832745 2:86224098-86224120 GAGGCTGCTAAGTGCCTTTTAGG - Intronic
934663215 2:96154105-96154127 GTGGCCACCAAGGGCATCTCAGG + Intergenic
935763453 2:106342575-106342597 GAGATTGCCATGGGCATCTCTGG - Intergenic
935921848 2:108024065-108024087 AAGGCTGGCAAGAGTATTTCTGG + Intergenic
935939287 2:108221423-108221445 GAGGCTGCAGAGGGCATCTCAGG - Intergenic
936067895 2:109345845-109345867 GAGGCTGTCCTGGGCATTGCAGG + Intronic
936783841 2:116068327-116068349 GAGGCTGCGAAGGGTAGTTGTGG - Intergenic
937031744 2:118746420-118746442 GTCGGTGCCAAGGGCATTTGTGG + Intergenic
938075379 2:128330185-128330207 GACACTGTCAAGGGCATTTCTGG + Intergenic
939126831 2:138187588-138187610 GAGGATGACAAGAGCATTCCAGG - Intergenic
939530942 2:143361032-143361054 GAACGTGCCAATGGCATTTCTGG - Intronic
943846552 2:192656159-192656181 GAACCTGCCCAGGGCTTTTCTGG - Intergenic
944912814 2:204327042-204327064 GAGGCTGCCCAGGATAATTCTGG + Intergenic
946935591 2:224717093-224717115 AAGGCTGCCAGGGGTATTTTGGG + Intergenic
947835130 2:233169827-233169849 CAGGATGCAAAGGGCATTTGAGG - Intronic
1170789834 20:19498518-19498540 GAGGCTGCATAGGGCAAATCAGG - Intronic
1171234181 20:23510883-23510905 GAGGCTGCCAAGTCCATACCTGG - Intergenic
1173300521 20:41798334-41798356 GATGCTGTCTGGGGCATTTCAGG + Intergenic
1173361964 20:42352571-42352593 GAGGCTGGGAAGGGCAGTACCGG + Intronic
1175166536 20:57048252-57048274 GGGGCTGCCCTGGGCATTGCAGG - Intergenic
1175172195 20:57088599-57088621 GAGGCTGCCACAGGGATTTGCGG + Intergenic
1178185012 21:30208998-30209020 AAGGATGACAAGGGCATTGCCGG + Intergenic
1178484252 21:33007340-33007362 GAGGTTGCCCAGGCAATTTCAGG + Intergenic
1180205264 21:46255819-46255841 GAGGCTGACAAGGGCAGCTACGG + Intronic
1180627419 22:17203385-17203407 GAGGCTGCCCAGTCCATTTCAGG + Intronic
1182223224 22:28775024-28775046 GAGGCTGAGAAGGGCAGATCAGG + Intronic
1182777553 22:32842053-32842075 GAGGCTGCCTAGGTTATTGCAGG + Intronic
1184416609 22:44355519-44355541 GAGGCAGCCACGGGCATCTCTGG - Intergenic
949166960 3:954414-954436 GAAGCTGCCCAGGGCCTTGCTGG - Intergenic
950077941 3:10200425-10200447 GAAGCTGCCAAAGGCTTTTCTGG - Exonic
950576257 3:13833811-13833833 CTGACTGCCAAGGCCATTTCAGG - Intronic
951136098 3:19106343-19106365 CAGCCTGCCAAGGGCAAGTCAGG + Intergenic
951983490 3:28591720-28591742 GAGGCTGCAATGTGCATTGCAGG - Intergenic
953853528 3:46484047-46484069 GGGCCTTCCAAGGGCATCTCTGG - Intronic
954001280 3:47559138-47559160 GAGGCTGAAAAGGGCAATTTAGG - Intergenic
954454560 3:50590747-50590769 GGGGCTCCCAAGGACCTTTCAGG - Intergenic
955378956 3:58421626-58421648 AAGGCTGTCAAGGGGGTTTCTGG + Intronic
956556734 3:70532068-70532090 GAAGCTGCCAAAGGCACCTCTGG + Intergenic
960954505 3:123022304-123022326 GATGCTGGCCAGGACATTTCTGG + Intronic
961179487 3:124865397-124865419 GAGTTTGATAAGGGCATTTCTGG - Intronic
962075717 3:132079994-132080016 GATGCTGCCAAGGGGACTTCAGG + Intronic
962847619 3:139285801-139285823 GTGGCTGCCAAGGACAGTGCAGG + Intronic
966246108 3:177809236-177809258 CAGGCTGCCCAGGGCACTTGCGG - Intergenic
967124690 3:186413266-186413288 GAAGCAGCCAAGGCCATTCCCGG + Intergenic
967233887 3:187366558-187366580 GAAGCTGAGAATGGCATTTCAGG - Intergenic
967886356 3:194336376-194336398 GAGGCTGCCCAGGGCATGGGAGG - Intergenic
969286301 4:6204473-6204495 GCGGAGGCCAAGGGCATTTTGGG - Intergenic
970582111 4:17482909-17482931 AAGGCAGCCAAGGGCATCTGAGG - Intronic
971782010 4:31048607-31048629 GAGGCTTCCAAGGACTTTTGTGG - Intronic
973138418 4:46735154-46735176 GAGACTGCTTAGTGCATTTCTGG + Exonic
976077780 4:81319421-81319443 GAGGCTGCCATGGGGAAGTCAGG - Intergenic
979143130 4:117203557-117203579 GAGGCTGGCAAGGGCAGTGGAGG + Intergenic
983071852 4:163277242-163277264 AAGGCTGCCAAGAATATTTCTGG + Intergenic
983397515 4:167219178-167219200 GATGTTGCCAAGGGCACCTCAGG + Intronic
983452893 4:167929277-167929299 GAGGGTGTCAAGGGCGATTCTGG + Intergenic
983929318 4:173435580-173435602 GAGACTGCCAGGGGCTTGTCAGG + Intergenic
985835384 5:2268138-2268160 CAGGCTGCCAGGGGGACTTCCGG + Intergenic
985874746 5:2586171-2586193 TTGGCTGCCCAGAGCATTTCTGG - Intergenic
986224383 5:5799642-5799664 GAGGCTTCCAAGGCCAGGTCAGG - Intergenic
987309244 5:16666864-16666886 GAGGGTGCCCAGGGAATGTCTGG - Intronic
989707758 5:44358027-44358049 GAGGGGGGCAAGGGCATTTCTGG + Intronic
991058143 5:62342167-62342189 GGGGCTGCCACGGGCAGTTGGGG + Intronic
992713590 5:79486362-79486384 GAGGCTGGCAAGAGCTTGTCAGG + Intronic
994975362 5:106797499-106797521 GAGGCAAACAAGGGCATCTCAGG - Intergenic
995436239 5:112139134-112139156 GAACCTGCCAATGGCATGTCTGG + Intergenic
997512456 5:134463025-134463047 GAGGATGCCAAGGCCTTCTCAGG - Intergenic
997585088 5:135039260-135039282 GGGGCTGCCACGGGCTTCTCAGG + Intronic
999061235 5:148638220-148638242 GGAGCTCCCATGGGCATTTCTGG + Intronic
999138064 5:149336604-149336626 GAGGCGGCCCAGGGCATCACAGG + Intronic
1000170823 5:158701603-158701625 GATGATGCCAAGGGCATGCCTGG + Intronic
1000416050 5:160984847-160984869 GAGACTGCCCAGTGCATGTCTGG - Intergenic
1001704023 5:173728947-173728969 GATGCTGCTAAGTGGATTTCTGG - Intergenic
1004372098 6:15061495-15061517 GAGCCCGGGAAGGGCATTTCAGG + Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1006246008 6:32736740-32736762 GAGGCTGCCATGTGCATTGCAGG + Intergenic
1006634233 6:35450857-35450879 GAGGATGCACAGGGCATTGCAGG + Intergenic
1008443583 6:51561294-51561316 GAAGCTGCCCTAGGCATTTCAGG - Intergenic
1011449499 6:87477754-87477776 GAGGCTGTCATGGGGATTGCAGG - Intronic
1012950973 6:105517580-105517602 GAGGCTGGGAAGGGTATTTTGGG + Intergenic
1015965677 6:138693397-138693419 GGGGCTGCCAAGGGGAGTTGGGG - Intergenic
1017410571 6:154163273-154163295 GAGTGTGCCTAGGGCATTTAAGG - Intronic
1019440223 7:1042212-1042234 GTGGCTGCTGAGGGCATTTGAGG - Intronic
1020434399 7:8147159-8147181 GGAGCTGTCAAGGGCATGTCAGG - Intronic
1023946440 7:44806648-44806670 GGGCTTGCAAAGGGCATTTCTGG - Intronic
1025099574 7:56123598-56123620 GGGCCTGCCAAGGGCATTCTGGG + Intergenic
1025104208 7:56157568-56157590 GAGACTGACAAGGGCACTTAGGG - Intergenic
1026316580 7:69232670-69232692 GAGACTGACAAGGGCACTTAGGG + Intergenic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1032752559 7:134856277-134856299 GAGGTTGCCATGGGCATTCCTGG - Intronic
1032865079 7:135916873-135916895 GAGGGTGCCATGGGCTTTTTTGG + Intergenic
1033950767 7:146781588-146781610 GAGGCAGCCCAGCGCGTTTCCGG - Intronic
1036798668 8:11773625-11773647 GAGGGAGGAAAGGGCATTTCAGG + Intronic
1037234975 8:16709070-16709092 GAGACTACCAAGGACATTCCAGG - Intergenic
1037668122 8:20989461-20989483 GAGGCTGGGAAGGGGAGTTCAGG - Intergenic
1040135214 8:43845386-43845408 GAGTCTGCGAAGGGAATTTTTGG + Intergenic
1041390423 8:57342815-57342837 GAGGCTGCCAAGAGCAGAGCAGG - Intergenic
1041974621 8:63783180-63783202 GAGGATGCCAAATGCAGTTCAGG + Intergenic
1046717455 8:117583430-117583452 AAGGCTGTCATGGGCATCTCAGG + Intergenic
1048774520 8:137931405-137931427 GAGGCTGCCCTGTGCATTGCAGG + Intergenic
1050233078 9:3549222-3549244 GAGGCAGCAGAGGGCATTTCAGG - Intergenic
1052820887 9:33137263-33137285 GAGAGTGGGAAGGGCATTTCTGG - Intronic
1053445177 9:38147098-38147120 ACGCCTGCCAAGGGCAATTCAGG - Intergenic
1055141472 9:72881778-72881800 GAGGCTGCCTCAGGGATTTCTGG + Intergenic
1055322093 9:75092228-75092250 GAGGCTGCCCAGGGAAGTCCCGG + Intronic
1055387638 9:75780490-75780512 GAGGCTGGGAAGGGCAATTGGGG + Intergenic
1055746176 9:79447869-79447891 GATGCTGCGAGGGTCATTTCTGG + Intergenic
1059157059 9:111999501-111999523 AAGCCTGCCAAGAGCATTCCTGG - Intergenic
1061512483 9:131069546-131069568 GATGCTGCCTAGGGCATTCTGGG + Intronic
1061974379 9:134061058-134061080 GAGACTGCTACTGGCATTTCTGG - Intronic
1062642067 9:137524075-137524097 AAGGCTGCCAGGGGCATTGGAGG - Intronic
1190817562 X:53941687-53941709 GTGGCTACCACGGGCATTTCTGG + Intronic
1192439473 X:71164163-71164185 CAGGCTGCCAAGGGCAACTATGG + Exonic
1195279758 X:103320019-103320041 GAGGCTGGGAAGGGTATTTGGGG - Intergenic
1197010155 X:121551164-121551186 CAGGGTGCCAAGAGCATCTCTGG + Intergenic
1197449599 X:126594996-126595018 CATGGTGCCAAGAGCATTTCTGG - Intergenic
1198061722 X:133052664-133052686 GGGACTGCCATGTGCATTTCAGG + Intronic
1198102725 X:133436113-133436135 AAGGCTGCCAAGGGCAGTTCAGG + Intergenic
1199238970 X:145525099-145525121 GAGGCTGCCTCGGCCATGTCTGG + Intergenic
1200228290 X:154431462-154431484 GGGGCAGCCAAGAGCATTTGTGG - Intronic
1200624127 Y:5490941-5490963 GAGGCAGCCATGGGCATGTCAGG - Intronic
1201779100 Y:17698688-17698710 GAATCTGCCAAGGGCAGTTGAGG - Intergenic
1201822456 Y:18207304-18207326 GAATCTGCCAAGGGCAGTTGAGG + Intergenic