ID: 1112334774

View in Genome Browser
Species Human (GRCh38)
Location 13:98505168-98505190
Sequence CCGGAAACACAGATCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112334770_1112334774 15 Left 1112334770 13:98505130-98505152 CCTCTGAACGGGATCTCAACTTT 0: 1
1: 0
2: 1
3: 8
4: 53
Right 1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112334774 Original CRISPR CCGGAAACACAGATCCACCA AGG Intronic
900085646 1:894441-894463 CCAGAAAGACAGAAACACCATGG + Intergenic
905400744 1:37701304-37701326 CAGGAAAGACAGATCCATCACGG + Intronic
906868751 1:49452430-49452452 CCAGAAACACAGATTCGACAAGG - Intronic
907583276 1:55591402-55591424 CCTAAAACACAGATACACCTGGG - Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
1067140336 10:43650792-43650814 TGGGAAACACAGAGCCACAAAGG + Intergenic
1068690906 10:59912847-59912869 AGGCAAACACAAATCCACCATGG + Intergenic
1072368787 10:94743323-94743345 CCAGACACACAGATTCTCCAAGG - Intronic
1072713178 10:97731409-97731431 CCAGAACAAGAGATCCACCAGGG - Intergenic
1073344993 10:102776294-102776316 CCGCACACACAGGCCCACCAGGG + Intronic
1074551920 10:114451722-114451744 TGGGAAAAACAGATCAACCAAGG + Intronic
1077342623 11:2032838-2032860 CCCCACACACACATCCACCATGG + Intergenic
1077499021 11:2900775-2900797 GCGGGAACACAGATGAACCAAGG + Intronic
1078097628 11:8310382-8310404 CCAGAAACCCAGACCCAACAGGG - Intergenic
1079639008 11:22780767-22780789 CCTGAGACACAGAACCACCTTGG - Intronic
1083570791 11:63761453-63761475 CAGGAGTCACAGATCCACCGTGG + Exonic
1089099661 11:115952180-115952202 CCTGGAACTTAGATCCACCAGGG + Intergenic
1089208688 11:116786248-116786270 CAGGAAACACAGATAACCCAAGG + Intronic
1202825609 11_KI270721v1_random:88027-88049 CCCCACACACACATCCACCATGG + Intergenic
1097633712 12:62096199-62096221 CAGGAATCCCAGATCCAGCAGGG - Intronic
1097958087 12:65506657-65506679 CCTGAAACACATATCCATGATGG + Intergenic
1100983716 12:100185420-100185442 CTGGAAACACAGAACCACTGTGG - Intergenic
1104729577 12:131097592-131097614 CTGGAGTCACAGATCCGCCAGGG + Intronic
1107055528 13:36099600-36099622 CCGGAAACATCGATTCAGCATGG - Intronic
1110640656 13:77820084-77820106 TGGGAAACACTGATCAACCAAGG - Intergenic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1113160815 13:107378915-107378937 CCTGAAACACAGAACAATCAGGG + Intronic
1115019829 14:28663180-28663202 ACAGAAACACACATCCAACAGGG - Intergenic
1115473404 14:33791450-33791472 CAGGAAACACAGATCCATTTAGG + Intronic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1117531845 14:56667301-56667323 CAGGACACCCAAATCCACCAAGG - Intronic
1120388053 14:83869985-83870007 CAGGAAACAAAGATCCAACTGGG - Intergenic
1121637127 14:95461530-95461552 ACGGAACCACAGAAGCACCATGG - Intronic
1122385341 14:101341543-101341565 CCAGAGAAACAGAACCACCAGGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1123175285 14:106410795-106410817 CTGCAAACACAGAGACACCAAGG + Intergenic
1123186176 14:106518883-106518905 CTGCAAACACAGAGACACCAAGG + Intergenic
1123188408 14:106542457-106542479 CATGAACCACACATCCACCAAGG + Intergenic
1123189716 14:106557249-106557271 CTGCAAACACAGAAACACCAAGG + Intergenic
1123200420 14:106658030-106658052 CTGCAAACACAGAGACACCAAGG + Intergenic
1202843338 14_GL000009v2_random:144474-144496 CCAGAAAGACAGAAACACCATGG + Intergenic
1202912734 14_GL000194v1_random:134712-134734 CCAGAAAGACAGAAACACCATGG + Intergenic
1202879906 14_KI270722v1_random:47970-47992 CCAGAAAGACAGAAACACCAAGG - Intergenic
1202943404 14_KI270726v1_random:4984-5006 CTGCAAACACAGAGACACCAAGG - Intergenic
1131506661 15:93025595-93025617 CAGGAATCAGAAATCCACCAGGG - Exonic
1133742322 16:8660937-8660959 ACGGAAACCCAGAGCTACCAGGG + Intergenic
1135526075 16:23214748-23214770 CCTGAACCAGAGATCCATCATGG + Exonic
1136229252 16:28877285-28877307 GCAGAGACACAGAGCCACCAGGG - Intergenic
1136458203 16:30394451-30394473 CTGGAAACACAGCTCCAGCCAGG + Intronic
1137769247 16:51003118-51003140 CTGGAAACACAACGCCACCAAGG - Intergenic
1137881837 16:52057599-52057621 CGGGAAACAGAGATCCAAAAGGG + Intronic
1138438833 16:57022294-57022316 CCTGAATCTCAGCTCCACCATGG + Exonic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1140715525 16:77722558-77722580 CCGGAAACAAACATTCCCCAGGG + Exonic
1140946052 16:79769522-79769544 CCTGCAACACACATCCACCTCGG - Intergenic
1141746039 16:85926829-85926851 CCGGAACCACAGATGACCCAGGG + Intergenic
1142807799 17:2380576-2380598 CCGCATACACAGCTCCTCCAAGG - Exonic
1142878340 17:2865996-2866018 CCTGAAGCAGAGATCAACCATGG + Intronic
1146884035 17:36459147-36459169 CCCTAAACAGAAATCCACCATGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148153900 17:45411910-45411932 CCAGAAACTCTGAGCCACCAGGG + Intronic
1152284307 17:79403486-79403508 CCGTGAACACAGCCCCACCATGG + Intronic
1153424892 18:4952371-4952393 CCAAAAACACATCTCCACCAGGG + Intergenic
1160014354 18:75129057-75129079 ACGGCAACACACCTCCACCATGG - Intergenic
1160517835 18:79488245-79488267 CCGCAAACACACACACACCAGGG - Intronic
1162478936 19:10916743-10916765 CCGGAAATACTCATCCACCGCGG - Exonic
1165946092 19:39443433-39443455 TCAGAACCACGGATCCACCAAGG + Intronic
1167249819 19:48393866-48393888 CCGGACACACAGATCCTCACCGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1202655523 1_KI270708v1_random:16990-17012 CCAGAAAGACAGAAACACCAAGG - Intergenic
936946420 2:117935105-117935127 CAGGTACCACAGATCCACCGAGG + Intronic
945802217 2:214447973-214447995 CCAGAAGCCCAGAACCACCAGGG + Intronic
947615978 2:231557217-231557239 CCGGGAACACAGACCCAAGAGGG + Intergenic
948377259 2:237529745-237529767 CCGGAACCGCAGTTTCACCAAGG + Intronic
1171502545 20:25604813-25604835 CCGGCAGCGCTGATCCACCATGG + Intergenic
1174166163 20:48584929-48584951 CCAGAAACACAGATCCAAGTGGG + Intergenic
1175260720 20:57672593-57672615 CCCGAAAGACAGAGCCACCCCGG - Intronic
1175880774 20:62257511-62257533 CAGAGAACACAGAACCACCATGG - Intronic
1176632094 21:9149390-9149412 CCAGAAAGACAGAAACACCATGG + Intergenic
1176641209 21:9305433-9305455 CCGGAAAGACAGAAACACCATGG - Intergenic
1177265784 21:18781594-18781616 CCGCAATCACAGACTCACCAAGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1180350229 22:11794814-11794836 CCGGAAAGACAGAAACACCATGG - Intergenic
1180374515 22:12078261-12078283 CCAGAAAGACAGAAACACCATGG - Intergenic
1180387984 22:12197437-12197459 CCAGAAAGACAGAAACACCATGG + Intergenic
1180905601 22:19408876-19408898 CCTCTAACACGGATCCACCAGGG + Intronic
1181845804 22:25707866-25707888 CCAGAAACACCGAGGCACCAGGG - Intronic
953667846 3:44938819-44938841 CCGGAAACAGTCCTCCACCACGG + Intronic
954826857 3:53381113-53381135 CAGGATACACAGATTCTCCAAGG + Intergenic
957094319 3:75764262-75764284 CGTGAAACACAAATCCTCCATGG + Intronic
960391084 3:117078331-117078353 CCTCTAACACATATCCACCAAGG + Intronic
960559476 3:119067498-119067520 TAGGAAACAAAGACCCACCAAGG - Intronic
960570142 3:119177849-119177871 CCATAAACACATATCCACAATGG + Intronic
961453846 3:127014758-127014780 CCGCACACACACCTCCACCAGGG - Exonic
961705735 3:128783609-128783631 CCGAAGGCATAGATCCACCAAGG - Intronic
1202745687 3_GL000221v1_random:99593-99615 CCGGAAAGACAGAAACACCATGG + Intergenic
968480309 4:830290-830312 CCGGGGACCCTGATCCACCAGGG + Intergenic
968582324 4:1400872-1400894 CCAGAAACACAGAGCCACACCGG - Intergenic
969173068 4:5379368-5379390 CAGGAAACACAGCTCCTCCCGGG + Intronic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
1202756100 4_GL000008v2_random:63700-63722 CCAGAAAGACAGAAACACCATGG - Intergenic
990529143 5:56656662-56656684 CTGGTAACACTGATCCACCTGGG + Intergenic
999701998 5:154236794-154236816 CTGGAAACTGAGATCCCCCAGGG + Intronic
1000258779 5:159565965-159565987 CCTGAAACACAGATCAAGAAGGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003257771 6:4489255-4489277 CCGGACACACAGAGACACCGGGG - Intergenic
1018719345 6:166561122-166561144 CAGGAAACACACCTCCAACATGG - Intronic
1019133680 6:169895263-169895285 CCAGAAAAACAGAACCAACAGGG + Intergenic
1021866504 7:24963437-24963459 CAGGCAACACAGACTCACCATGG + Intronic
1022887383 7:34660737-34660759 CCGGAAGGAAAGATACACCATGG - Intronic
1023216450 7:37868229-37868251 CCCTAAACAAAAATCCACCATGG - Intronic
1030314442 7:108099601-108099623 ATGGAAACACAGAACCACAAAGG - Intronic
1032310335 7:130780342-130780364 CCAGAAACACCCATCCTCCAAGG - Intergenic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1037763729 8:21758803-21758825 CCGGAGCCACAGGTCCACCGTGG + Intronic
1042165936 8:65946278-65946300 CCGGAAACACAGCTCACCCCAGG - Intergenic
1044937213 8:97304750-97304772 CCGGAATCACTGATCCAATAGGG - Intergenic
1045516234 8:102863433-102863455 CCGGAAACAGCAATGCACCACGG + Intronic
1045531728 8:102991395-102991417 CCGGGAACACAGAGCTACCAGGG - Intergenic
1048577399 8:135703961-135703983 ACGGAAGCTCAGATGCACCAGGG + Intergenic
1051122870 9:13771201-13771223 CAGGAAACACAGCGCTACCAGGG - Intergenic
1061901884 9:133677263-133677285 CTGGAAACCCACATCCTCCAGGG + Intronic
1203754921 Un_GL000218v1:117009-117031 CCAGAAAGACAGAAACACCATGG + Intergenic
1203714306 Un_KI270742v1:129549-129571 CCGGAAAGACAGAAACACCATGG + Intergenic
1203536903 Un_KI270743v1:48537-48559 CCAGAAAGACAGAAACACCATGG - Intergenic
1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG + Intergenic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1189863074 X:45293153-45293175 CCATAAACACAGACCAACCATGG - Intergenic
1194875761 X:99185941-99185963 TGGGAAACAAAGATCCAGCAAGG + Intergenic
1195862945 X:109400534-109400556 CAGGAAAGAGAAATCCACCATGG + Intronic
1200825518 Y:7635353-7635375 CGGGAAACACAGTTCTGCCATGG + Intergenic
1201168545 Y:11234617-11234639 CCAGAAAGACAGAAACACCATGG + Intergenic
1201647855 Y:16255047-16255069 CAGGAAGCACAGATTCCCCATGG - Intergenic
1201654955 Y:16330254-16330276 CAGGAAGCACAGATTCCCCATGG + Intergenic
1201978430 Y:19880170-19880192 CCAGTGACACTGATCCACCAAGG + Intergenic
1202234539 Y:22695742-22695764 CGGGAAACACAGTTCTGCCATGG - Intergenic
1202308620 Y:23500426-23500448 CGGGAAACACAGTTCTGCCATGG + Intergenic
1202562181 Y:26170160-26170182 CGGGAAACACAGTTCTGCCATGG - Intergenic