ID: 1112337306

View in Genome Browser
Species Human (GRCh38)
Location 13:98525854-98525876
Sequence CCTTCTATTCAGACCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112337306 Original CRISPR CCTTCTATTCAGACCCTGCA TGG (reversed) Intronic
900589384 1:3453042-3453064 CCTTCTGTCCAGCCCCTGCTGGG - Intergenic
901024577 1:6272397-6272419 GCTCCTGTTCAGACCCTCCATGG - Intronic
901564607 1:10102962-10102984 CCTGCTCTTCAGACACTTCAGGG - Exonic
902302565 1:15512398-15512420 CGTTCTATTCAGGCCCTTGACGG - Intronic
902871236 1:19314766-19314788 CCTTGTGTTCAGACTCTGCAAGG + Intronic
903956494 1:27029652-27029674 CCATCTGATCCGACCCTGCAGGG + Intergenic
904165637 1:28553152-28553174 CCTTGTCTTCAGACCCCGGACGG - Intronic
905252709 1:36659816-36659838 CCTTCTGTTCCCACCCTCCATGG + Intergenic
905653782 1:39672889-39672911 CCCTCTATCCAGCCCCTTCATGG - Intergenic
909808431 1:79900858-79900880 TGTTCTATTCAGACCCTCAAGGG + Intergenic
910050660 1:82970282-82970304 CCTTCTAGATAAACCCTGCAAGG + Intergenic
912812693 1:112805845-112805867 CTTTCTATTCCCACCATGCAAGG + Intergenic
916474221 1:165153284-165153306 CCTGCTATTGTCACCCTGCATGG - Intergenic
922188614 1:223297639-223297661 CCTCCTATTCAGACTCTGCAGGG - Intronic
922614456 1:226953477-226953499 CCTTCTCCTCAGGCCCTGCCTGG - Intronic
923791690 1:237116827-237116849 TGTTCTATTCAGGCCCTGAATGG + Intronic
924098726 1:240581917-240581939 GTTTCTATTTAGAGCCTGCAAGG + Intronic
924620138 1:245653228-245653250 CCTTCTATTCACTTCCTCCAAGG - Intronic
1064050840 10:12058245-12058267 CCAACTATTCAGACCCAGAAGGG - Intergenic
1070892816 10:79954687-79954709 CCTTCTATTGGGGCCCTGGATGG + Intronic
1074212042 10:111344157-111344179 TCTTCTATTCAGGCCCTCGATGG + Intergenic
1074260242 10:111846365-111846387 TCTTCTATTCAGACCCTCAACGG + Intergenic
1082793329 11:57362476-57362498 CCTTCTGTCCTGACACTGCATGG + Intronic
1084723884 11:70927836-70927858 TGTTCTATTCAGACCCTCAACGG - Intronic
1084882750 11:72183502-72183524 CTCTCCATCCAGACCCTGCAAGG + Intergenic
1086609417 11:88736677-88736699 CCTTCAATTCCCATCCTGCAGGG - Intronic
1089789326 11:120931271-120931293 CATTCTCTCCAGTCCCTGCAGGG - Intronic
1089913569 11:122128412-122128434 ACTTTTATTCAGCCCCTGGAGGG - Intergenic
1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG + Intergenic
1092990204 12:13890083-13890105 CCTTCCTTTCAGCCCCTGCTGGG + Intronic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1100039913 12:90302950-90302972 TGTTCTCTTCAGACCCTGGATGG + Intergenic
1102785864 12:115604373-115604395 CCTTCTATTCAGTCTCCTCATGG - Intergenic
1105853159 13:24353606-24353628 TGTTCTATTCAGGCCCTCCATGG + Intergenic
1106398041 13:29400598-29400620 CCCTCTATTCAGTCCATGAAGGG - Intronic
1108165527 13:47688948-47688970 TCTTCTAATCAGAGCCTGCAAGG + Intergenic
1108553126 13:51566125-51566147 ACTTATATTCAGAACCTCCAAGG - Intergenic
1110999261 13:82157340-82157362 TCTTCTATTCAGACCCTCAAGGG + Intergenic
1112337306 13:98525854-98525876 CCTTCTATTCAGACCCTGCATGG - Intronic
1113156288 13:107326708-107326730 TCTTATATTCTGTCCCTGCAGGG - Intronic
1113511142 13:110855620-110855642 CCTTCTCTGCAGAGCCAGCAAGG - Intergenic
1119056479 14:71427160-71427182 CCTTTTATTTTTACCCTGCAGGG + Intronic
1120396131 14:83969664-83969686 TCTTCTCTTCTGACCCTGCCAGG + Intergenic
1123727674 15:23120812-23120834 CCTTCTAAACAGATTCTGCAAGG - Intergenic
1124221619 15:27854393-27854415 GCTCCTTCTCAGACCCTGCAAGG - Intronic
1126205838 15:46043683-46043705 GCTTTTGTTCAGACTCTGCAGGG - Intergenic
1127968925 15:63944138-63944160 CCTTTTATCCAGACCCAGCTTGG - Intronic
1129834728 15:78694991-78695013 CCTCCTATTCTGAGGCTGCAAGG - Intronic
1130690894 15:86080521-86080543 CCTTCTAGTCAGATCCTGCCTGG - Intergenic
1130993318 15:88889718-88889740 CCTTCCACTCAGCCCCTGCAGGG - Intronic
1130994715 15:88897390-88897412 CCTTTTATTCAGACCCTGCTAGG + Intergenic
1131249183 15:90819582-90819604 CCATCTACTCAGTCCCTGCCAGG + Intergenic
1133702626 16:8323357-8323379 CATTCTTTTTAGACCATGCAAGG + Intergenic
1134040019 16:11061176-11061198 CCTTTTCTTCAAAACCTGCATGG - Intronic
1134094707 16:11411729-11411751 CCTGCTGTCCAGACCCTGCTGGG - Intronic
1134192738 16:12135107-12135129 TCTTCTACTCAGGCCCTGCTTGG + Intronic
1135253687 16:20923032-20923054 TGTTCTATTCAGGCCCTCCATGG + Intronic
1135912776 16:26576741-26576763 TGCTCTATTCAGACCCTGAATGG + Intergenic
1136649334 16:31653714-31653736 CCATATATTCACACCCAGCATGG + Intergenic
1137572745 16:49577541-49577563 CCTTCTCTTTTGACCCTGCTTGG - Intronic
1139733173 16:68965378-68965400 CTTTCTACTCTCACCCTGCAGGG + Intronic
1148674881 17:49439356-49439378 CCCTCCATTCAGTCCCTACAAGG + Intronic
1150322200 17:64224621-64224643 CCATCTCTTCCGACCCAGCAGGG + Intronic
1151270947 17:72995579-72995601 TGTTCTATTCAGGCCCTCCATGG - Intronic
1151291208 17:73151376-73151398 CCTGGTATTTACACCCTGCACGG - Intergenic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1151696789 17:75721906-75721928 CCTTCTTTGCAAACCCTGGAGGG - Intronic
1152522593 17:80867377-80867399 CCTTCTATTAGGAGTCTGCAGGG - Intronic
1156263618 18:35467069-35467091 CCTACTGCTCAGACCCTCCAGGG - Intronic
1157184214 18:45524388-45524410 CATTCTATTCACACCCTACTGGG - Intronic
1159261966 18:66025787-66025809 TGTTCTATTCAGACCCTTGATGG + Intergenic
1161080133 19:2306483-2306505 CCTTCTATTCCCACTCAGCAAGG + Intronic
1164223172 19:23215328-23215350 CCATATATTCACACCCAGCATGG - Intergenic
1164779750 19:30882869-30882891 CTTTCCATTCACACCCTGCAGGG + Intergenic
1167829592 19:52008487-52008509 CCTTCTATTCAGCTGCTGAAAGG - Intergenic
926464545 2:13170881-13170903 TCTTCTATTTAGTCCCTACAGGG - Intergenic
932289731 2:70566714-70566736 AATTCTATTCAGGCCCTGCTTGG - Intergenic
932369639 2:71176484-71176506 CCTCCTATTCTGAGGCTGCAAGG - Intergenic
937774098 2:125755408-125755430 TGTTCTATTCAGACCCTGCATGG + Intergenic
938165606 2:129023208-129023230 CCTACTATTCAGAATCTACAAGG - Intergenic
939753053 2:146072810-146072832 TCTTCTATTCAGACCCTCAATGG - Intergenic
942116910 2:172736404-172736426 CCGGCTATTCAGACCTTGCGGGG + Intronic
942387323 2:175456103-175456125 CTTTCTATTAAGACAATGCAGGG - Intergenic
946069737 2:217023694-217023716 TGTTCTATTCAGGCCCTGGAGGG + Intergenic
946570146 2:221015512-221015534 TATTCTATTTAGACCCTCCATGG + Intergenic
946801256 2:223418289-223418311 CTTTCTATTAAAACTCTGCAGGG - Intergenic
947024728 2:225724399-225724421 CAACCTATTCAGACCCTCCATGG - Intergenic
1168813751 20:722854-722876 ACTTCAATACAGAGCCTGCAGGG + Intergenic
1173194764 20:40905179-40905201 CCTTCTCTACAGCCTCTGCAGGG - Intergenic
1174877829 20:54246734-54246756 TGTTCTATTCAGAGCCTGAATGG + Intergenic
1178025835 21:28465508-28465530 GCTTCTATTAAGATCCTGGAAGG + Intergenic
1179076090 21:38123148-38123170 TCTTCTATTCTGACCCTGGATGG + Intronic
1179119211 21:38527556-38527578 CCTCCTCTTCAGACCCTTCCTGG - Intronic
1182479181 22:30595688-30595710 CCCTGCATCCAGACCCTGCAAGG + Intronic
1182594618 22:31409468-31409490 CCTTCAAATCAGAATCTGCAGGG + Intronic
950201654 3:11048668-11048690 CTTTCTCTCCATACCCTGCAAGG + Intergenic
953083308 3:39641810-39641832 CCTTCTATTGATCCCCTTCAAGG - Intergenic
953493981 3:43371066-43371088 CCTTCTATTCATAGCATTCAGGG + Intronic
953964925 3:47296983-47297005 CCTACTACTCAGATCCAGCAAGG - Intronic
954142957 3:48619785-48619807 CCTTCTTCCCAGGCCCTGCAAGG - Intergenic
954431358 3:50472508-50472530 CCTTCTATAGAGATCCTCCAAGG + Intronic
954972776 3:54664919-54664941 CCTTCTCTACATAGCCTGCATGG - Intronic
957451257 3:80385502-80385524 TATTCTATTCAGACTCTGAAAGG + Intergenic
957977785 3:87469825-87469847 CCTTCACTTCAGACCCTGACTGG + Intergenic
958995209 3:100896247-100896269 CAAGCTATTCAGACCATGCATGG - Intronic
967040103 3:185684252-185684274 CCTCTTATTCAGTCCCTTCAGGG + Intronic
972632415 4:40853768-40853790 CTTTCTATTCACTCCCTACATGG + Intronic
973960209 4:56102350-56102372 CGTTCTAATCAGAGCCAGCATGG + Intergenic
975815955 4:78217192-78217214 TGTTCTATTCAGGCCCTCCAAGG + Intronic
976846566 4:89495318-89495340 TGTTCTATTCAGGCCCTGAATGG - Intergenic
977446782 4:97140690-97140712 TGTTCTATTCAGGCCCTGGATGG + Intergenic
980970105 4:139559545-139559567 CCTTCTCTTCATACCCAGCTTGG + Intronic
981279307 4:142939080-142939102 TCTTCTATTTGGACCCTCCATGG - Intergenic
985922369 5:2987565-2987587 TCTTCTATTCAGGACCTGAATGG - Intergenic
992027100 5:72681283-72681305 GCTTATATTCAGGCCCTGCAAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997008704 5:129850732-129850754 TCTTCCATTCAGACTCTGGAAGG - Intergenic
997452178 5:133992577-133992599 TCTTCTTATCAGACCCTGCTGGG - Intronic
999073311 5:148770794-148770816 TGTTCTATTCAGGCCCTCCATGG - Intergenic
1000019116 5:157303690-157303712 CCTCCTCTGCATACCCTGCAGGG + Intronic
1003773774 6:9336950-9336972 CCTCCTAATCAAACCCAGCAAGG + Intergenic
1004398188 6:15264934-15264956 GCTTCTGTTCAGACCCAGCTGGG + Intronic
1005723776 6:28629023-28629045 TGTTCTATTCAGACCCTCAATGG + Intergenic
1008327200 6:50196984-50197006 GCTTTCATTAAGACCCTGCAGGG - Intergenic
1008552312 6:52644732-52644754 GCTTCATTTCAGACCATGCATGG - Intergenic
1011124628 6:83993869-83993891 TATTCTGTTCAGACACTGCAAGG + Intergenic
1011557766 6:88587712-88587734 CCTGGGACTCAGACCCTGCAGGG - Intergenic
1011583155 6:88894564-88894586 CCTTCAACTCAGGCCTTGCAAGG - Intronic
1012867718 6:104638006-104638028 CCCTCTTTCCAGACACTGCATGG - Intergenic
1014454256 6:121619186-121619208 TGTTCTATTCAGGCCCTCCATGG + Intergenic
1017444569 6:154495757-154495779 ACGTGTATTCAGACCCTGCCAGG + Intronic
1017724741 6:157269010-157269032 CATTTTCTTCAGAACCTGCAGGG - Intergenic
1018463677 6:164022801-164022823 CCTGCTGTTCAGAGCCTGCATGG + Intergenic
1023133305 7:37025533-37025555 TGTTCTATTCAGACCCTCAAGGG - Intronic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1026217173 7:68359891-68359913 TCTTCTATTCAGGGCCTCCATGG - Intergenic
1026358489 7:69581005-69581027 TGTTCTATTCAGACCCTCAATGG - Intergenic
1028997336 7:97115991-97116013 CCTTCTAATGAGACCCTCCCTGG - Intergenic
1029353732 7:100034378-100034400 CCTTCCACACAGCCCCTGCAGGG + Exonic
1030764750 7:113395240-113395262 CCTCCTATTCAGACTCTGTTAGG + Intergenic
1030766245 7:113413345-113413367 TGTTCTATTCAGACCCTCAAAGG + Intergenic
1032128513 7:129211465-129211487 CCTTCTCTTCAGATTCTGAAGGG + Intronic
1033839629 7:145358535-145358557 TGTTCTATTCAGACACTTCACGG - Intergenic
1036403636 8:8433217-8433239 CCTTCTAATCAGATTCTCCAGGG + Intergenic
1039799107 8:40938889-40938911 CCCTCTCTTCCGGCCCTGCAGGG + Intergenic
1040277587 8:46021863-46021885 TCTTCTCATCAGCCCCTGCATGG - Intergenic
1043397058 8:79848501-79848523 ACTTATATTCAGACTCTACAAGG + Intergenic
1043565163 8:81539793-81539815 CCTATGATTCAGACCCTGCTGGG + Intergenic
1045500243 8:102739034-102739056 CCCTCCATACAGACCCTCCACGG - Intergenic
1045610235 8:103831700-103831722 TTTTCTTTTCAAACCCTGCAAGG + Intronic
1051397270 9:16637420-16637442 CCATCTATCCAGAACATGCAGGG + Intronic
1052922860 9:33986261-33986283 CCTTTTTTTGAGACCCTGCCTGG - Intronic
1054872541 9:70061507-70061529 CCTTCTCTTCATCCCCTGTAGGG + Intronic
1056440856 9:86619751-86619773 CCTTCTACCCTGACCCTGCCTGG - Intergenic
1060765839 9:126294585-126294607 CCTTGTCTTCAGGCCCAGCAAGG + Intergenic
1061948121 9:133920187-133920209 CCTTCTAGTCAGCCCCAGAAAGG + Intronic
1198257628 X:134938402-134938424 CCCTCTATTCTAACCCTGTAAGG + Intergenic
1200770263 Y:7118434-7118456 TCTTCTATTCAAAGCCTGCCAGG + Intergenic
1201240615 Y:11954127-11954149 CCTTTTATTCAGGCGCTGCTAGG - Intergenic