ID: 1112344366

View in Genome Browser
Species Human (GRCh38)
Location 13:98577320-98577342
Sequence CCGGCCCCGCCGCCCGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 0, 2: 10, 3: 114, 4: 687}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112344366_1112344377 -4 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344377 13:98577339-98577361 CCGGGAGGGGGCCTCGGCTGGGG 0: 1
1: 0
2: 1
3: 36
4: 355
1112344366_1112344375 -5 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344375 13:98577338-98577360 GCCGGGAGGGGGCCTCGGCTGGG 0: 1
1: 1
2: 4
3: 34
4: 315
1112344366_1112344374 -6 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344374 13:98577337-98577359 GGCCGGGAGGGGGCCTCGGCTGG 0: 1
1: 0
2: 11
3: 77
4: 607
1112344366_1112344378 -1 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344378 13:98577342-98577364 GGAGGGGGCCTCGGCTGGGGCGG 0: 1
1: 1
2: 7
3: 92
4: 832
1112344366_1112344390 30 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344390 13:98577373-98577395 AGGGACCGAGTCGGGGCCGGAGG 0: 1
1: 0
2: 0
3: 33
4: 199
1112344366_1112344382 7 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344382 13:98577350-98577372 CCTCGGCTGGGGCGGGCGCCGGG 0: 1
1: 0
2: 1
3: 43
4: 411
1112344366_1112344380 6 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344380 13:98577349-98577371 GCCTCGGCTGGGGCGGGCGCCGG 0: 1
1: 1
2: 10
3: 54
4: 648
1112344366_1112344384 11 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344384 13:98577354-98577376 GGCTGGGGCGGGCGCCGGGAGGG 0: 1
1: 2
2: 5
3: 133
4: 1185
1112344366_1112344389 27 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344389 13:98577370-98577392 GGGAGGGACCGAGTCGGGGCCGG 0: 1
1: 0
2: 1
3: 42
4: 555
1112344366_1112344379 0 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344379 13:98577343-98577365 GAGGGGGCCTCGGCTGGGGCGGG 0: 1
1: 0
2: 5
3: 109
4: 871
1112344366_1112344385 21 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344385 13:98577364-98577386 GGCGCCGGGAGGGACCGAGTCGG 0: 1
1: 0
2: 1
3: 22
4: 153
1112344366_1112344373 -10 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344373 13:98577333-98577355 GCGGGGCCGGGAGGGGGCCTCGG 0: 1
1: 1
2: 10
3: 153
4: 1085
1112344366_1112344383 10 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344383 13:98577353-98577375 CGGCTGGGGCGGGCGCCGGGAGG 0: 1
1: 0
2: 8
3: 144
4: 1214
1112344366_1112344386 22 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344386 13:98577365-98577387 GCGCCGGGAGGGACCGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 104
1112344366_1112344387 23 Left 1112344366 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG 0: 1
1: 0
2: 10
3: 114
4: 687
Right 1112344387 13:98577366-98577388 CGCCGGGAGGGACCGAGTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112344366 Original CRISPR CCGGCCCCGCCGCCCGCCCG CGG (reversed) Intronic