ID: 1112344432

View in Genome Browser
Species Human (GRCh38)
Location 13:98577483-98577505
Sequence CCCGGGACGCGTTTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112344432_1112344445 8 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344445 13:98577514-98577536 TGAGGGCAGGATCGGAGTCGGGG 0: 1
1: 0
2: 1
3: 14
4: 184
1112344432_1112344443 6 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344443 13:98577512-98577534 CCTGAGGGCAGGATCGGAGTCGG 0: 1
1: 0
2: 0
3: 14
4: 199
1112344432_1112344438 -5 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344438 13:98577501-98577523 CCGGGCGAGCCCCTGAGGGCAGG 0: 1
1: 0
2: 4
3: 26
4: 429
1112344432_1112344448 17 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344448 13:98577523-98577545 GATCGGAGTCGGGGGCACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1112344432_1112344446 9 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344446 13:98577515-98577537 GAGGGCAGGATCGGAGTCGGGGG 0: 1
1: 0
2: 6
3: 22
4: 185
1112344432_1112344439 0 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344439 13:98577506-98577528 CGAGCCCCTGAGGGCAGGATCGG 0: 1
1: 0
2: 2
3: 22
4: 197
1112344432_1112344435 -9 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344435 13:98577497-98577519 CGTCCCGGGCGAGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1112344432_1112344449 18 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344449 13:98577524-98577546 ATCGGAGTCGGGGGCACCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1112344432_1112344434 -10 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344434 13:98577496-98577518 GCGTCCCGGGCGAGCCCCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1112344432_1112344450 22 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344450 13:98577528-98577550 GAGTCGGGGGCACCTGGGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 359
1112344432_1112344447 16 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344447 13:98577522-98577544 GGATCGGAGTCGGGGGCACCTGG 0: 1
1: 0
2: 3
3: 9
4: 122
1112344432_1112344444 7 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344444 13:98577513-98577535 CTGAGGGCAGGATCGGAGTCGGG 0: 1
1: 0
2: 1
3: 18
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112344432 Original CRISPR CCCGGGACGCGTTTTCCCAG AGG (reversed) Intronic
900314705 1:2050901-2050923 CCCGGGACCGGGTTTCCCTGGGG + Intronic
920040294 1:203091057-203091079 GCAGGGACGGGATTTCCCAGTGG - Intronic
922116578 1:222618731-222618753 CTCGGTGGGCGTTTTCCCAGTGG + Intronic
1068575237 10:58676824-58676846 CTCTGGAAGCTTTTTCCCAGAGG - Intronic
1075207244 10:120457831-120457853 CCTGGCGAGCGTTTTCCCAGCGG + Intronic
1077442999 11:2577448-2577470 CCCAGGCCGCGTCTTCCCCGAGG - Intronic
1080002276 11:27363228-27363250 GCGGGGACGCGCTTTCCCAGCGG + Exonic
1082127751 11:48453183-48453205 CTCTGGAAGCTTTTTCCCAGAGG + Intergenic
1083904266 11:65659969-65659991 CCTGGGACTCAGTTTCCCAGTGG + Intronic
1085433949 11:76482023-76482045 CCCTGGAGGCTTTGTCCCAGAGG - Intronic
1090318485 11:125818714-125818736 CCCTGGAAGCTTTGTCCCAGAGG - Intergenic
1093998231 12:25665794-25665816 CTCTGGAAGCTTTTTCCCAGAGG + Intergenic
1103742431 12:123099838-123099860 CCTGGGAGGCCTATTCCCAGGGG + Intronic
1106336501 13:28788554-28788576 CCCTGGAAGCTTTGTCCCAGAGG + Intergenic
1108940647 13:55948415-55948437 CCCTGGAAGCTTTGTCCCAGAGG - Intergenic
1110942109 13:81363317-81363339 CTCTGGAAGCGTTGTCCCAGAGG - Intergenic
1112344432 13:98577483-98577505 CCCGGGACGCGTTTTCCCAGAGG - Intronic
1116212658 14:41968177-41968199 CTCTGGAAGCGTTGTCCCAGAGG + Intergenic
1118899274 14:69973027-69973049 CCTGGGACATGTTTCCCCAGAGG + Intronic
1119466471 14:74862722-74862744 CCCAGGACTCATCTTCCCAGAGG - Intronic
1129051222 15:72783529-72783551 CCCGGGACCCGTCTCCCCCGAGG - Exonic
1142198065 16:88747957-88747979 ACCGGGCTGCGTTTTTCCAGGGG - Intronic
1142372386 16:89690369-89690391 CCCGAGACGCGTTCCCCCGGAGG - Intronic
1145123548 17:20281823-20281845 CCAGGGAAGTGTTTCCCCAGAGG + Intronic
1147035425 17:37676319-37676341 CCCGGGTCTCCTTTTCCCAGAGG + Intergenic
1148772612 17:50076000-50076022 TCAGGGACCCCTTTTCCCAGAGG - Intronic
1149281188 17:55107783-55107805 CCCTGGAAGCTTTGTCCCAGAGG + Intronic
1151858260 17:76737923-76737945 CCCGGGACTACGTTTCCCAGCGG + Exonic
1157451377 18:47791692-47791714 CCCGGAAAGAGTTTTCACAGAGG + Intergenic
1160679563 19:406546-406568 CCCGGGACGCCCCCTCCCAGGGG - Exonic
1163334225 19:16660846-16660868 CGCGGGACGCCCGTTCCCAGGGG - Intergenic
1163607073 19:18281382-18281404 CCCGGGCCGCTTGTTCCCCGGGG - Exonic
1163829553 19:19541181-19541203 CCCGGGACACGCATCCCCAGCGG - Exonic
1168445026 19:56404292-56404314 CCCCGGACTCCATTTCCCAGCGG + Intronic
1168696973 19:58409087-58409109 CCCGGGACGCGTTTCGGCTGAGG + Exonic
929775536 2:44928951-44928973 CCCGGGACGCGGTCTCCGGGCGG + Intergenic
931881951 2:66577544-66577566 CCCGGGACTCGTTTTCCGCCTGG - Intergenic
934059866 2:88283857-88283879 CCGGGCACGCTTTTTCCTAGGGG - Intergenic
941041389 2:160627925-160627947 CTCTGGAAGCTTTTTCCCAGAGG + Intergenic
948823314 2:240561124-240561146 CCGGGGACGAGTTTTCCGGGCGG + Intronic
1179947337 21:44687167-44687189 CCCAGCACGCGTTTCCCCAGAGG + Intronic
1181811233 22:25405020-25405042 CCCGGGACGCGGCGTCCCCGGGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185259779 22:49854736-49854758 GCCGGGACGTGTTTCCACAGAGG - Intronic
965433718 3:168620977-168620999 CCCAGGACAGGTTTTCCCAGTGG + Intergenic
965880548 3:173382930-173382952 CTCGGGAAGCTTTGTCCCAGAGG - Intergenic
969538002 4:7768533-7768555 CTCTGGACTCGTTTTCTCAGTGG - Intronic
975227597 4:71892174-71892196 CCCTGGAAGCCTTGTCCCAGTGG - Intergenic
976193694 4:82513214-82513236 CTCTGGAAGCTTTTTCCCAGAGG - Intronic
979588167 4:122445676-122445698 CTCTGGAAGCTTTTTCCCAGTGG + Intergenic
982817545 4:159905198-159905220 CCCAGGATGCTCTTTCCCAGTGG + Intergenic
984224495 4:177017968-177017990 CCCTGGAAGCTTTGTCCCAGAGG - Intergenic
991199940 5:63980270-63980292 CCCTGGAAGCTTTGTCCCAGAGG + Intergenic
994437978 5:99763159-99763181 CCCTGGAAGCTTTGTCCCAGAGG + Intergenic
995695828 5:114876999-114877021 CCCTGGAAGCTTTGTCCCAGAGG - Intergenic
1003987619 6:11452563-11452585 CCCCGGAAGCTTTGTCCCAGAGG - Intergenic
1006254083 6:32815351-32815373 CCAGGCATGGGTTTTCCCAGAGG - Intronic
1008864071 6:56188751-56188773 CCAGGGAAGCTTTGTCCCAGAGG - Intronic
1009194000 6:60663314-60663336 CTCTGGAAGCTTTTTCCCAGAGG + Intergenic
1034978014 7:155459069-155459091 GCCGGGACGCGTGGTCCCCGCGG - Intronic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1045287995 8:100808407-100808429 CCCTGGATTCTTTTTCCCAGGGG + Intergenic
1049389529 8:142360757-142360779 GCCGGGGCGCTTTGTCCCAGGGG - Intronic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1187257450 X:17655754-17655776 CCCGGCACCTGATTTCCCAGTGG + Intronic
1190946048 X:55095263-55095285 CTCTGGAAGCTTTTTCCCAGAGG + Intronic
1191115479 X:56847522-56847544 CCCTGGAAGCTTCTTCCCAGAGG - Intergenic
1192790707 X:74379680-74379702 CCTGGGAAGTGTTCTCCCAGAGG - Intergenic