ID: 1112344432

View in Genome Browser
Species Human (GRCh38)
Location 13:98577483-98577505
Sequence CCCGGGACGCGTTTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112344432_1112344438 -5 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344438 13:98577501-98577523 CCGGGCGAGCCCCTGAGGGCAGG 0: 1
1: 0
2: 4
3: 26
4: 429
1112344432_1112344445 8 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344445 13:98577514-98577536 TGAGGGCAGGATCGGAGTCGGGG 0: 1
1: 0
2: 1
3: 14
4: 184
1112344432_1112344450 22 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344450 13:98577528-98577550 GAGTCGGGGGCACCTGGGGAAGG 0: 1
1: 0
2: 4
3: 36
4: 359
1112344432_1112344448 17 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344448 13:98577523-98577545 GATCGGAGTCGGGGGCACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1112344432_1112344449 18 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344449 13:98577524-98577546 ATCGGAGTCGGGGGCACCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1112344432_1112344444 7 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344444 13:98577513-98577535 CTGAGGGCAGGATCGGAGTCGGG 0: 1
1: 0
2: 1
3: 18
4: 262
1112344432_1112344443 6 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344443 13:98577512-98577534 CCTGAGGGCAGGATCGGAGTCGG 0: 1
1: 0
2: 0
3: 14
4: 199
1112344432_1112344434 -10 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344434 13:98577496-98577518 GCGTCCCGGGCGAGCCCCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1112344432_1112344447 16 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344447 13:98577522-98577544 GGATCGGAGTCGGGGGCACCTGG 0: 1
1: 0
2: 3
3: 9
4: 122
1112344432_1112344439 0 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344439 13:98577506-98577528 CGAGCCCCTGAGGGCAGGATCGG 0: 1
1: 0
2: 2
3: 22
4: 197
1112344432_1112344446 9 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344446 13:98577515-98577537 GAGGGCAGGATCGGAGTCGGGGG 0: 1
1: 0
2: 6
3: 22
4: 185
1112344432_1112344435 -9 Left 1112344432 13:98577483-98577505 CCTCTGGGAAAACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1112344435 13:98577497-98577519 CGTCCCGGGCGAGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112344432 Original CRISPR CCCGGGACGCGTTTTCCCAG AGG (reversed) Intronic