ID: 1112344719

View in Genome Browser
Species Human (GRCh38)
Location 13:98579508-98579530
Sequence GGATGAAACAATGGTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112344719_1112344722 23 Left 1112344719 13:98579508-98579530 CCACACTGACCATTGTTTCATCC 0: 1
1: 0
2: 1
3: 9
4: 251
Right 1112344722 13:98579554-98579576 GCACCATTCTTATCGAAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1112344719_1112344723 24 Left 1112344719 13:98579508-98579530 CCACACTGACCATTGTTTCATCC 0: 1
1: 0
2: 1
3: 9
4: 251
Right 1112344723 13:98579555-98579577 CACCATTCTTATCGAAAGAAGGG 0: 1
1: 0
2: 2
3: 7
4: 113
1112344719_1112344725 28 Left 1112344719 13:98579508-98579530 CCACACTGACCATTGTTTCATCC 0: 1
1: 0
2: 1
3: 9
4: 251
Right 1112344725 13:98579559-98579581 ATTCTTATCGAAAGAAGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112344719 Original CRISPR GGATGAAACAATGGTCAGTG TGG (reversed) Intergenic
900723720 1:4200160-4200182 GAATGATACAATGGACATTGAGG + Intergenic
901770225 1:11526435-11526457 GGAAGAAACAAGGCTCAGAGAGG + Intronic
901795053 1:11675179-11675201 GGAGGAGACAAAGGTCAGGGGGG + Intronic
902678201 1:18023730-18023752 GGATGACACAATGGACTTTGGGG + Intergenic
905251044 1:36648649-36648671 GAATGATACAATGGACACTGGGG + Intergenic
905294763 1:36947215-36947237 GGATGAAACAAAGGCATGTGAGG - Intronic
906876636 1:49546051-49546073 GAATGATACAATGGCCTGTGGGG - Intronic
907463421 1:54619773-54619795 GGATCAGACACTGGTCACTGTGG - Intronic
907825541 1:58013382-58013404 GCATCACACAATGGTCAGAGAGG - Intronic
907964230 1:59313774-59313796 GAATGACACAATGGACATTGGGG + Intronic
910899162 1:92101099-92101121 GAATGATACAATGGACAATGGGG - Intronic
914378121 1:147091473-147091495 GGATGACACAATGGACTTTGGGG + Intergenic
915218263 1:154354146-154354168 GGGAAAAACAATGTTCAGTGTGG - Intergenic
916837659 1:168564692-168564714 GAATGATACAATGGTCTTTGGGG + Intergenic
916844634 1:168637216-168637238 GGAGGAAACAATGGTAATTCAGG - Intergenic
917212495 1:172644670-172644692 AGAAGAAAAAAAGGTCAGTGAGG - Intergenic
917307044 1:173637894-173637916 GGCTGCTACAATGGGCAGTGGGG - Intronic
918572886 1:186019494-186019516 GAATGAAACCATAATCAGTGAGG - Intronic
918978834 1:191528278-191528300 GGGAGAAACAATGTTCAGGGAGG + Intergenic
919961583 1:202475539-202475561 GGAGGAAACAGTGTTCATTGTGG + Intronic
920631024 1:207651781-207651803 GCATGATGCAATGATCAGTGAGG + Intronic
923675257 1:236075277-236075299 TGATGAATAAATGGTCAGTATGG - Intergenic
924470442 1:244338390-244338412 GGATGATACAATGGACTTTGGGG - Intergenic
1063401124 10:5746880-5746902 TGATAAAACAATGGTCATGGAGG + Exonic
1065079505 10:22113501-22113523 GAATGATACAATGGACACTGGGG - Intergenic
1065296013 10:24275999-24276021 GGAAAAAGAAATGGTCAGTGAGG - Intronic
1065451426 10:25862590-25862612 GAGAGAAAAAATGGTCAGTGAGG + Intergenic
1065913435 10:30330863-30330885 AGATGAAACACTGGTCAGCCTGG + Intronic
1065991061 10:31010999-31011021 GGATTAAATAATAGCCAGTGAGG + Intronic
1066706339 10:38183068-38183090 GAATGAAACAATGGACTTTGGGG - Intergenic
1069181265 10:65362078-65362100 TAATGAGACAATGGTCAGTAAGG - Intergenic
1069256565 10:66338672-66338694 GGATGAGACAAAGATCAGGGAGG + Intronic
1072380418 10:94863231-94863253 GAATGATACAATGGACTGTGGGG - Intergenic
1074519462 10:114205534-114205556 GGCTGAAAGAATGGTCAGCATGG - Intronic
1075680444 10:124327317-124327339 GGAGGAGACAATGATCAGAGAGG - Intergenic
1075824182 10:125340145-125340167 GAATGATACAATGGTCTCTGGGG + Intergenic
1079663764 11:23076818-23076840 AGATGAAACAATAGGCACTGGGG + Intergenic
1083377306 11:62235033-62235055 GAATGATACAATGGACATTGGGG + Intergenic
1085265206 11:75233781-75233803 GGGTGAAACAATGGAATGTGGGG + Intergenic
1086251836 11:84825104-84825126 GGAAGAAACAATGTTTGGTGGGG + Intronic
1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG + Intergenic
1087136529 11:94726342-94726364 GGATGAATAAATGCCCAGTGTGG - Intronic
1088025059 11:105169431-105169453 GAATGATACAATGGACATTGGGG - Intergenic
1088984643 11:114894769-114894791 GGCTGGAACAGTGGTCAGAGTGG + Intergenic
1091406315 12:211593-211615 GGATGAAAAAATGGGGAGTTGGG + Intronic
1091593066 12:1856866-1856888 GGATGACAGAAAGGCCAGTGGGG + Intronic
1091936485 12:4439011-4439033 GAATGAAACACTGGTAACTGGGG + Intronic
1092984252 12:13829981-13830003 GGATGGAACAAGAGTCTGTGTGG + Intronic
1095252771 12:39998352-39998374 GAATGAAACAATGGACTTTGGGG + Intronic
1095270677 12:40215079-40215101 AGATGGAACAAGGCTCAGTGGGG - Intronic
1095515788 12:43003827-43003849 GAAGGAAACAATAGACAGTGGGG + Intergenic
1096496959 12:52044203-52044225 GGATGAGGCACTGGTCACTGCGG + Intronic
1097278776 12:57831527-57831549 GAAAGATACAATGGTCACTGTGG + Intronic
1098139985 12:67441479-67441501 GGATGAAAGAAATGGCAGTGAGG + Intergenic
1100140985 12:91618753-91618775 GGATAACAGAATGGACAGTGAGG + Intergenic
1101340091 12:103835717-103835739 GGAGGAAACCAAGGTCAGAGAGG + Intronic
1101452205 12:104789887-104789909 GAATGATACAATGGACTGTGGGG - Intergenic
1101475157 12:105039061-105039083 GGTAAAAACAATGGTCACTGAGG - Intronic
1102738448 12:115184278-115184300 GAATGAAACAATGGTTACTGGGG + Intergenic
1102784517 12:115593403-115593425 GAATGACACAATGGACTGTGGGG - Intergenic
1103662009 12:122527520-122527542 AGATGAAACACTTGTCAGTTAGG - Intronic
1105660591 13:22489955-22489977 AGTTGTATCAATGGTCAGTGTGG + Intergenic
1105897302 13:24727118-24727140 GGATGGAGGAAGGGTCAGTGAGG + Intergenic
1107983046 13:45751743-45751765 GGATAAAACAATGACCTGTGAGG - Intergenic
1108281786 13:48868797-48868819 GGAAGGAACAATGGTAACTGTGG + Intergenic
1108424131 13:50280929-50280951 GAAGGAAACAATGGACAGTGGGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109503441 13:63267967-63267989 GGATAAAACAATGGACTTTGGGG - Intergenic
1111476449 13:88755040-88755062 GGCTGGAACCATGCTCAGTGTGG + Intergenic
1112344719 13:98579508-98579530 GGATGAAACAATGGTCAGTGTGG - Intergenic
1116223824 14:42122009-42122031 GAATGACACAGTGGTCACTGGGG + Intergenic
1116732478 14:48641647-48641669 GAATGACACAATGGACTGTGGGG + Intergenic
1116987882 14:51240432-51240454 GGATGATAGAATTGTGAGTGCGG + Exonic
1117110708 14:52451088-52451110 GAATGAAATAATGGGCATTGGGG + Intronic
1117536544 14:56708103-56708125 GGATGAAACAATGGGCAGGGTGG - Intronic
1118045244 14:61963077-61963099 GGAGGAACAACTGGTCAGTGGGG - Intergenic
1119225611 14:72942664-72942686 AGATGAAACAATGGTCTGGAGGG - Intronic
1120287862 14:82527661-82527683 TGATGAATCAATGGTCCTTGTGG + Intergenic
1120519238 14:85507421-85507443 GGATAAAACAATGGGAAGGGAGG + Intergenic
1121165264 14:91790309-91790331 TGGTGAAACAGTTGTCAGTGTGG + Intronic
1124862531 15:33456598-33456620 GGATGGAAAAATGGTCTATGTGG - Intronic
1126333062 15:47554873-47554895 GGATGAAACTATGCTCAGCAGGG + Intronic
1126652846 15:50943071-50943093 TGATGAAACAATAGACACTGGGG - Intronic
1129364204 15:75044354-75044376 GGAAGAAAAAGGGGTCAGTGTGG - Intronic
1129984349 15:79904097-79904119 GGAGGAAACCATGGTAAATGTGG + Intronic
1131956006 15:97736828-97736850 GGATGAAGCATTGGGAAGTGAGG - Intergenic
1132095301 15:98980002-98980024 GAATGATACAATGGACACTGGGG + Intronic
1133153765 16:3857243-3857265 GGATGAAAAAGTGGTCACGGTGG - Intronic
1134930753 16:18205876-18205898 GAATGATACAATGGACTGTGGGG + Intergenic
1135126415 16:19813687-19813709 GCAAGAAACAATGGTGAATGAGG + Intronic
1135153416 16:20030933-20030955 GGTTGAAACAATGGCAAGTGTGG + Intergenic
1135489970 16:22900648-22900670 TGGAGAAAGAATGGTCAGTGGGG + Intronic
1135648991 16:24189002-24189024 GGAGGAAAGAAAGGGCAGTGAGG - Intronic
1138876421 16:60956255-60956277 TGAAGAAACAATGATCAGTCAGG - Intergenic
1139685464 16:68599898-68599920 TGATGGAACAATGGGCAGAGAGG - Intergenic
1141260264 16:82447045-82447067 GGATGATACAATGGACCTTGGGG + Intergenic
1141787698 16:86212873-86212895 GGAAGAAGCCATGGTCTGTGTGG - Intergenic
1141787762 16:86213161-86213183 GGAAGGAACCATGGTCTGTGTGG - Intergenic
1143608807 17:8006052-8006074 GAATCAACCAATGGTCAGAGAGG + Intronic
1144161241 17:12560940-12560962 GGATGATACAATGGACTTTGGGG - Intergenic
1145158951 17:20561477-20561499 GAATGATACAATGGACATTGGGG + Intergenic
1146092431 17:29893223-29893245 GGATGAAATTCTGGTGAGTGTGG - Intronic
1146413528 17:32610469-32610491 GGAAGAAAGGATGGTAAGTGGGG + Intronic
1146468931 17:33109063-33109085 GGATGATACAATGGACTTTGGGG + Intronic
1147731586 17:42607127-42607149 GGATAAAACACTCTTCAGTGAGG + Intronic
1148519380 17:48256074-48256096 GGAGGAAACCATGCTAAGTGTGG - Intronic
1150194043 17:63275645-63275667 GGATGAAATAATGAACAATGAGG - Intronic
1153166685 18:2269481-2269503 GAAGGAAATAATGTTCAGTGAGG - Intergenic
1155040036 18:22057275-22057297 GGAAGAGACAATGAGCAGTGAGG - Intergenic
1156806443 18:41188439-41188461 GGGGGAAACAATTGTAAGTGGGG + Intergenic
1157171636 18:45412256-45412278 GGATAAAACATTGTTCACTGTGG - Intronic
1159886235 18:73910003-73910025 GGATGTAACCATAGTCAATGAGG + Intergenic
1160276950 18:77445706-77445728 GAATGATACAATGGACACTGGGG - Intergenic
1160683875 19:424622-424644 CCTTGAAAGAATGGTCAGTGTGG - Intronic
1162638776 19:11990751-11990773 GAATGATACAATGGACTGTGGGG + Intergenic
1163604265 19:18265527-18265549 GGATGAGGCATTGGTCAGTGGGG + Exonic
1165986554 19:39774455-39774477 GGATGATACAATGGACTTTGGGG + Intergenic
1167758592 19:51428752-51428774 GGATGGAACAAAGGTCAGAGAGG + Intergenic
1167981723 19:53281665-53281687 GGAGGAATCCAGGGTCAGTGGGG + Intergenic
1167984369 19:53301997-53302019 GGAGGAATCCAGGGTCAGTGGGG - Intergenic
925011790 2:491191-491213 GGATGAAGGAATGAGCAGTGGGG + Intergenic
925581363 2:5414761-5414783 AGATTAAACTATGTTCAGTGTGG - Intergenic
925677449 2:6379197-6379219 GAATGATACAATGGTCTTTGGGG + Intergenic
927718326 2:25367018-25367040 GGATGGAATAATTGTAAGTGTGG + Intergenic
931840982 2:66147949-66147971 AGAGAAAACAAAGGTCAGTGAGG + Intergenic
932638529 2:73416077-73416099 GGCTCAAACCATGGTCAGAGAGG + Intronic
935007594 2:99095216-99095238 GGATGATACAATGGACTTTGGGG + Intronic
936233492 2:110724615-110724637 GGATCAGACAATGCCCAGTGGGG + Intergenic
936510370 2:113140213-113140235 GAATGATACAATGGTCTTTGGGG - Intergenic
939417049 2:141913443-141913465 GGCTGAAAAAATGGTGAGTTTGG + Intronic
941344826 2:164354990-164355012 GAATGAAGCATTGCTCAGTGAGG - Intergenic
943909768 2:193548295-193548317 GAATGAAACAATGGACCTTGGGG + Intergenic
944452102 2:199853543-199853565 GGATGAAGGTAAGGTCAGTGAGG + Intergenic
945004606 2:205391053-205391075 GGATGAATCTGTGGCCAGTGTGG + Intronic
946018367 2:216621977-216621999 GGAGGAGACAAGGGTGAGTGGGG + Intergenic
946779637 2:223179768-223179790 GGATGGAACAAGGCTCAGAGAGG + Intronic
947533222 2:230925771-230925793 GTCTGCAAGAATGGTCAGTGGGG + Intronic
947970904 2:234323715-234323737 GGGGGGATCAATGGTCAGTGTGG - Intergenic
1169653024 20:7890719-7890741 GAATGATACAATGGACATTGGGG - Intronic
1170311949 20:15001882-15001904 GAATGATACAATGGACAGTGGGG - Intronic
1170852656 20:20018505-20018527 GGATAACACATTGGTAAGTGAGG + Intronic
1171116359 20:22527911-22527933 TGATGAAACAATGACCAGAGAGG - Intergenic
1172023777 20:31934396-31934418 GGATGCACACATGGTCAGTGTGG + Intronic
1173960389 20:47066845-47066867 GGCTGATACAATGCCCAGTGAGG - Intronic
1174711408 20:52709564-52709586 GAAGGAAACAATGGACACTGGGG + Intergenic
1175233037 20:57487353-57487375 GAATGATACAATGGTCTTTGGGG + Intergenic
1175547504 20:59788125-59788147 GAATGATACAATGGACATTGGGG - Intronic
1177231067 21:18320658-18320680 GGATGAAAAAATGCTGAATGGGG + Intronic
1177403492 21:20636754-20636776 GGATGAAGCAATGATAAATGAGG + Intergenic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1183906238 22:41042528-41042550 GAAGGAAACAATAGACAGTGTGG - Intergenic
1184864670 22:47195586-47195608 AGATGACACAAGGGTCAGGGAGG - Intergenic
950899267 3:16482618-16482640 TGAGGAAACAAGGCTCAGTGAGG - Intronic
954065296 3:48101077-48101099 GAATGAAACAATGGGCAGATTGG + Intergenic
954149206 3:48648823-48648845 GGCTAAAATAGTGGTCAGTGTGG + Exonic
954782852 3:53073532-53073554 GGCTGGACCAAGGGTCAGTGAGG + Intronic
955583930 3:60455796-60455818 TGAATAAACATTGGTCAGTGGGG + Intronic
956693176 3:71896354-71896376 GTATAAACCAATGGTTAGTGCGG + Intergenic
956861791 3:73331448-73331470 GGATGACACAATGGACTTTGGGG - Intergenic
957541815 3:81580704-81580726 GGATGGAACAGGGGTCAGGGAGG + Intronic
958578062 3:95977930-95977952 GAATGATACAATGGACTGTGGGG + Intergenic
958942189 3:100328898-100328920 GAATGAGACAATGGACTGTGGGG + Intergenic
959980425 3:112510215-112510237 GAATGATACAATGGTCTTTGGGG + Intergenic
960633144 3:119753832-119753854 GAATGATACAATGGACTGTGCGG - Intronic
962487108 3:135854438-135854460 GGATGATACAATGGACTTTGGGG - Intergenic
964101312 3:152991691-152991713 GAATGAAACAATGGACTTTGGGG - Intergenic
964190444 3:153994368-153994390 GAATGATACAATGGACTGTGGGG + Intergenic
964711746 3:159678265-159678287 GGATGAAATAATCTTCAATGAGG - Intronic
965362114 3:167754103-167754125 GGATAAAACAAAGGTAAATGTGG - Intronic
965557667 3:170034876-170034898 GAAGGAAAGAATGGACAGTGGGG + Intergenic
966807883 3:183820453-183820475 GGATGAAGAAAGGGTCAGAGAGG + Intronic
966979752 3:185121197-185121219 GAATGATACAATGGACATTGGGG + Intronic
967040183 3:185684818-185684840 GGGTGAAAAAATGGTATGTGGGG + Intronic
967210613 3:187165006-187165028 AGCTGAAACAATAGCCAGTGGGG + Intronic
971238031 4:24861453-24861475 GAATGAAACAATGGACTCTGGGG + Intronic
973179108 4:47246087-47246109 GAATGATACAATGGACTGTGGGG - Intronic
975510295 4:75187493-75187515 GGATGATACAATGGACTTTGCGG + Intergenic
976157646 4:82164540-82164562 GGATGATACAATGGACTTTGGGG + Intergenic
979274190 4:118796653-118796675 GGAGGAAGCTATGGTGAGTGGGG - Intronic
980152730 4:129068012-129068034 GGATGACACAATGGACTTTGGGG - Intronic
980391319 4:132151396-132151418 GAATGATACAATGGACATTGGGG - Intergenic
981355471 4:143784759-143784781 GGATGAAAGAATGGTTTTTGGGG + Intergenic
981559895 4:146036161-146036183 GAATGATACAATGGTCTCTGGGG + Intergenic
982492010 4:156041349-156041371 GAATGACACAATGGACTGTGGGG + Intergenic
986019953 5:3791801-3791823 GGAGGAAACAAGGCTCAGAGAGG - Intergenic
986110110 5:4707513-4707535 TGATGAAATTATTGTCAGTGGGG + Intergenic
986480977 5:8187701-8187723 AGATGAGTCAATGGTAAGTGTGG - Intergenic
986593030 5:9391237-9391259 GGATTAAATCCTGGTCAGTGAGG - Intronic
986610085 5:9558516-9558538 AGAGGAAACAAAGGTCAATGGGG - Intergenic
986610401 5:9561416-9561438 AGAAGAAACAATGGTCACTGAGG + Intergenic
987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG + Intergenic
987907255 5:24092858-24092880 GGGTGAAGCAAAGGACAGTGTGG - Intronic
989023597 5:37040732-37040754 GGTTGAAACAATGGTTATTTTGG + Intronic
990129469 5:52563517-52563539 GGAAGAAACAATGATTACTGTGG + Intergenic
991370167 5:65910345-65910367 GAATGATACAATGGACACTGAGG + Intergenic
993384634 5:87250333-87250355 GTATGAAACCATGGTGTGTGTGG - Intergenic
1001715396 5:173811169-173811191 GGAGGTGACAATGGTCATTGTGG + Intergenic
1003231553 6:4258191-4258213 AGATGAAACAATAGGCATTGTGG - Intergenic
1004831178 6:19478118-19478140 GGAAGAAATAATGGTAAGTAAGG - Intergenic
1005735919 6:28745974-28745996 GGATGGAACTATGTTCTGTGCGG + Intergenic
1006014911 6:31072702-31072724 GGAGGAAGCCATGGCCAGTGGGG - Intergenic
1006042643 6:31268971-31268993 GGAGGGAACACAGGTCAGTGTGG + Exonic
1006296562 6:33172520-33172542 AGAAGGAACAAAGGTCAGTGAGG - Exonic
1006722559 6:36167089-36167111 GAATGATACAATGGACTGTGGGG + Intergenic
1007376234 6:41458572-41458594 GGATGAGACCAAGGCCAGTGTGG - Intergenic
1007835056 6:44667811-44667833 GGATGAATCAAAGGTGTGTGGGG - Intergenic
1008245337 6:49164404-49164426 GGATGATACAATGGACTTTGGGG + Intergenic
1010266191 6:73871063-73871085 GTATGAAGCAATGGGAAGTGGGG - Intergenic
1011132628 6:84067057-84067079 GAATGAAACAATGGACTGTGGGG - Intronic
1015447975 6:133330014-133330036 TAATGAAACAATGTACAGTGAGG + Intronic
1015962452 6:138664082-138664104 GGATTAGATAATGGTCACTGTGG + Intronic
1016198555 6:141377891-141377913 GGCTGAGACAATGGACAATGGGG + Intergenic
1016393607 6:143599387-143599409 GGATGAATCAATAAACAGTGTGG - Intronic
1017688878 6:156943375-156943397 GGCTTAAACAAAGTTCAGTGGGG - Intronic
1019421460 7:953134-953156 GGAGGAAATAAAGGTCTGTGGGG + Intronic
1020792376 7:12642764-12642786 GGAAGAAACCATTGTAAGTGTGG - Intronic
1023159196 7:37281199-37281221 GAATGATACAATGGACTGTGGGG + Intronic
1023355627 7:39364438-39364460 GAATGATACAATGGACTGTGGGG - Intronic
1024432720 7:49308962-49308984 GCAAGAAACAATGGGCAGTAGGG - Intergenic
1024499587 7:50090271-50090293 GAATGATACAATGGTCTTTGGGG - Intronic
1026769292 7:73184191-73184213 GGATAACACAATGGTTAGTTTGG + Intergenic
1027010162 7:74737574-74737596 GGATAACACAATGGTTAGTTTGG + Intronic
1027077880 7:75208463-75208485 GGATAACACAATGGTTAGTTTGG - Intergenic
1027878288 7:83799919-83799941 GGAAGAAAGAAGGGTCAGTTTGG + Intergenic
1030782120 7:113614316-113614338 GAATGAAACAGTGGTTAATGTGG + Intergenic
1031963838 7:128013080-128013102 GGATGTAGCACTGGACAGTGTGG - Intronic
1033253673 7:139780709-139780731 AGATGAGACAAAAGTCAGTGGGG - Intronic
1033829041 7:145230003-145230025 GAAGGGAACAATGGTCACTGAGG - Intergenic
1038366752 8:26943814-26943836 GGATGATACAATGGACTTTGGGG - Intergenic
1039270066 8:35870182-35870204 GGATGATACAATGGACTTTGGGG - Intergenic
1039445574 8:37629173-37629195 GAATGAAACAATAGTCTTTGGGG + Intergenic
1039635992 8:39166218-39166240 GAATGATACAATGGACTGTGGGG - Intronic
1041944963 8:63430663-63430685 GGATGATACAATGGACTTTGGGG + Intergenic
1042635698 8:70871621-70871643 GGAGGAAAGATTGGTCAGTAGGG - Intergenic
1043608361 8:82030514-82030536 GAATGAAACAGTGGTTACTGGGG - Intergenic
1045222392 8:100211901-100211923 GGCAGAAACAATGGTCAGCTTGG - Intronic
1046631409 8:116626175-116626197 GGATGAATTAAGGTTCAGTGAGG + Intergenic
1047558383 8:125959050-125959072 GAATGATACAATGGTCTTTGGGG - Intergenic
1048338374 8:133520057-133520079 GGCTGAAAGAATGATGAGTGGGG - Intronic
1048969388 8:139636230-139636252 GGATGAAGGAATGCTCAGAGAGG + Intronic
1054844324 9:69776552-69776574 GAATGATACAATGGACATTGGGG - Intergenic
1055308924 9:74958196-74958218 GGATGAAAAAATAGTGTGTGGGG - Intergenic
1055928724 9:81537909-81537931 GAATGAAACAATGGACTTTGGGG - Intergenic
1057997361 9:99830070-99830092 GACTGAAATAATGGCCAGTGGGG - Intronic
1059467530 9:114478543-114478565 GGATGAGAAAAAGGTGAGTGGGG - Exonic
1062146948 9:134994787-134994809 GGATGCAACCCTGGTGAGTGTGG + Intergenic
1202801909 9_KI270720v1_random:8017-8039 GAATGATACAATGGTCTTTGGGG + Intergenic
1185552486 X:994194-994216 GGAAAACACAATGGTAAGTGGGG + Intergenic
1185580861 X:1210820-1210842 GGATGAATCAATGGACAGGTGGG + Intronic
1186013590 X:5165820-5165842 GGAAGAAAGAATGTTCAGAGAGG + Intergenic
1187017022 X:15339672-15339694 TGTTGAAACAAAGGTTAGTGTGG + Intergenic
1187218670 X:17301983-17302005 GAATGATACAATGGACTGTGGGG - Intergenic
1188500331 X:30818699-30818721 GAATGAAACAATGGACTTTGGGG - Intergenic
1190755042 X:53394396-53394418 GGATGAAAGAATGCCAAGTGAGG + Intronic
1191629191 X:63302750-63302772 GAATGATACAATGGTCTTTGGGG - Intergenic
1195464477 X:105165203-105165225 GAATAAATGAATGGTCAGTGGGG - Intronic
1197862913 X:130988941-130988963 GGATGAAAGAAGAATCAGTGAGG + Intergenic
1202067498 Y:20955440-20955462 TAATAAAACAATGGTCAGTGAGG + Intergenic
1202296739 Y:23366445-23366467 GGAGGAAACAGTGTTCATTGTGG + Intergenic
1202383558 Y:24300439-24300461 CAATGAAAGAATGGTCAGAGAGG - Intergenic
1202487225 Y:25369681-25369703 CAATGAAAGAATGGTCAGAGAGG + Intergenic
1202574068 Y:26304152-26304174 GGAGGAAACAGTGTTCATTGTGG - Intergenic