ID: 1112345376

View in Genome Browser
Species Human (GRCh38)
Location 13:98584890-98584912
Sequence AGATCCTTGGATCTAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112345376_1112345383 28 Left 1112345376 13:98584890-98584912 CCTGGTGCTAGATCCAAGGATCT No data
Right 1112345383 13:98584941-98584963 ACTTCTCCAGAGTCCCAGGCAGG No data
1112345376_1112345382 24 Left 1112345376 13:98584890-98584912 CCTGGTGCTAGATCCAAGGATCT No data
Right 1112345382 13:98584937-98584959 TCTGACTTCTCCAGAGTCCCAGG No data
1112345376_1112345381 -10 Left 1112345376 13:98584890-98584912 CCTGGTGCTAGATCCAAGGATCT No data
Right 1112345381 13:98584903-98584925 CCAAGGATCTTGGAGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112345376 Original CRISPR AGATCCTTGGATCTAGCACC AGG (reversed) Intergenic
No off target data available for this crispr