ID: 1112345874

View in Genome Browser
Species Human (GRCh38)
Location 13:98589102-98589124
Sequence CTTCCATCTCTTCTGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112345874_1112345879 3 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345879 13:98589128-98589150 AGAGAGGCAAGCCTGGCACCGGG No data
1112345874_1112345882 23 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345882 13:98589148-98589170 GGGCACTGCATCTCTCCTTGAGG No data
1112345874_1112345878 2 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345878 13:98589127-98589149 AAGAGAGGCAAGCCTGGCACCGG No data
1112345874_1112345877 -4 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345877 13:98589121-98589143 GAAGCTAAGAGAGGCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112345874 Original CRISPR CTTCCATCTCTTCTGGATCT TGG (reversed) Intergenic
No off target data available for this crispr