ID: 1112345877

View in Genome Browser
Species Human (GRCh38)
Location 13:98589121-98589143
Sequence GAAGCTAAGAGAGGCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112345874_1112345877 -4 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345877 13:98589121-98589143 GAAGCTAAGAGAGGCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112345877 Original CRISPR GAAGCTAAGAGAGGCAAGCC TGG Intergenic
No off target data available for this crispr