ID: 1112345878

View in Genome Browser
Species Human (GRCh38)
Location 13:98589127-98589149
Sequence AAGAGAGGCAAGCCTGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112345874_1112345878 2 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345878 13:98589127-98589149 AAGAGAGGCAAGCCTGGCACCGG No data
1112345875_1112345878 -5 Left 1112345875 13:98589109-98589131 CCAGAAGAGATGGAAGCTAAGAG No data
Right 1112345878 13:98589127-98589149 AAGAGAGGCAAGCCTGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112345878 Original CRISPR AAGAGAGGCAAGCCTGGCAC CGG Intergenic
No off target data available for this crispr