ID: 1112345882

View in Genome Browser
Species Human (GRCh38)
Location 13:98589148-98589170
Sequence GGGCACTGCATCTCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112345875_1112345882 16 Left 1112345875 13:98589109-98589131 CCAGAAGAGATGGAAGCTAAGAG No data
Right 1112345882 13:98589148-98589170 GGGCACTGCATCTCTCCTTGAGG No data
1112345874_1112345882 23 Left 1112345874 13:98589102-98589124 CCAAGATCCAGAAGAGATGGAAG No data
Right 1112345882 13:98589148-98589170 GGGCACTGCATCTCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112345882 Original CRISPR GGGCACTGCATCTCTCCTTG AGG Intergenic
No off target data available for this crispr