ID: 1112346720

View in Genome Browser
Species Human (GRCh38)
Location 13:98596289-98596311
Sequence CAGGGTCACCAGTCTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112346706_1112346720 28 Left 1112346706 13:98596238-98596260 CCTTGGCCTTCCACAGTCCTGGG No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data
1112346710_1112346720 18 Left 1112346710 13:98596248-98596270 CCACAGTCCTGGGATTATAGGCA No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data
1112346708_1112346720 22 Left 1112346708 13:98596244-98596266 CCTTCCACAGTCCTGGGATTATA No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data
1112346703_1112346720 30 Left 1112346703 13:98596236-98596258 CCCCTTGGCCTTCCACAGTCCTG No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data
1112346711_1112346720 11 Left 1112346711 13:98596255-98596277 CCTGGGATTATAGGCATGAGCAG No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data
1112346704_1112346720 29 Left 1112346704 13:98596237-98596259 CCCTTGGCCTTCCACAGTCCTGG No data
Right 1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112346720 Original CRISPR CAGGGTCACCAGTCTCAAAT GGG Intergenic
No off target data available for this crispr