ID: 1112354252

View in Genome Browser
Species Human (GRCh38)
Location 13:98660991-98661013
Sequence CTGAATATACAGATGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112354252_1112354259 18 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354259 13:98661032-98661054 CTGCACAGGGGTCCTAAAGAAGG No data
1112354252_1112354256 5 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354256 13:98661019-98661041 CACCTTCATCTTACTGCACAGGG No data
1112354252_1112354260 26 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354260 13:98661040-98661062 GGGTCCTAAAGAAGGATAACAGG No data
1112354252_1112354255 4 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354255 13:98661018-98661040 TCACCTTCATCTTACTGCACAGG No data
1112354252_1112354261 27 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354261 13:98661041-98661063 GGTCCTAAAGAAGGATAACAGGG No data
1112354252_1112354257 6 Left 1112354252 13:98660991-98661013 CCACGAGCCATCTGTATATTCAG No data
Right 1112354257 13:98661020-98661042 ACCTTCATCTTACTGCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112354252 Original CRISPR CTGAATATACAGATGGCTCG TGG (reversed) Intergenic
No off target data available for this crispr