ID: 1112355847

View in Genome Browser
Species Human (GRCh38)
Location 13:98674486-98674508
Sequence GAGGAAACTGAGGCACACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112355847_1112355850 -8 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355850 13:98674501-98674523 GTTTCCTCATCTGTGGCATGAGG No data
1112355847_1112355854 26 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355854 13:98674535-98674557 CTTACCTCCAAGGGCTGCTCAGG No data
1112355847_1112355853 17 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355853 13:98674526-98674548 GCTGATATGCTTACCTCCAAGGG No data
1112355847_1112355852 16 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355852 13:98674525-98674547 TGCTGATATGCTTACCTCCAAGG No data
1112355847_1112355855 27 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112355847 Original CRISPR GAGGAAACTGAGGCACACTG TGG (reversed) Intergenic