ID: 1112355849

View in Genome Browser
Species Human (GRCh38)
Location 13:98674496-98674518
Sequence TGCCACAGATGAGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112355849_1112355855 17 Left 1112355849 13:98674496-98674518 CCTCAGTTTCCTCATCTGTGGCA No data
Right 1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG No data
1112355849_1112355853 7 Left 1112355849 13:98674496-98674518 CCTCAGTTTCCTCATCTGTGGCA No data
Right 1112355853 13:98674526-98674548 GCTGATATGCTTACCTCCAAGGG No data
1112355849_1112355854 16 Left 1112355849 13:98674496-98674518 CCTCAGTTTCCTCATCTGTGGCA No data
Right 1112355854 13:98674535-98674557 CTTACCTCCAAGGGCTGCTCAGG No data
1112355849_1112355852 6 Left 1112355849 13:98674496-98674518 CCTCAGTTTCCTCATCTGTGGCA No data
Right 1112355852 13:98674525-98674547 TGCTGATATGCTTACCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112355849 Original CRISPR TGCCACAGATGAGGAAACTG AGG (reversed) Intergenic