ID: 1112355850

View in Genome Browser
Species Human (GRCh38)
Location 13:98674501-98674523
Sequence GTTTCCTCATCTGTGGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112355847_1112355850 -8 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355850 13:98674501-98674523 GTTTCCTCATCTGTGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112355850 Original CRISPR GTTTCCTCATCTGTGGCATG AGG Intergenic