ID: 1112355855

View in Genome Browser
Species Human (GRCh38)
Location 13:98674536-98674558
Sequence TTACCTCCAAGGGCTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112355849_1112355855 17 Left 1112355849 13:98674496-98674518 CCTCAGTTTCCTCATCTGTGGCA No data
Right 1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG No data
1112355847_1112355855 27 Left 1112355847 13:98674486-98674508 CCACAGTGTGCCTCAGTTTCCTC No data
Right 1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG No data
1112355851_1112355855 8 Left 1112355851 13:98674505-98674527 CCTCATCTGTGGCATGAGGATGC No data
Right 1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112355855 Original CRISPR TTACCTCCAAGGGCTGCTCA GGG Intergenic