ID: 1112356210

View in Genome Browser
Species Human (GRCh38)
Location 13:98676599-98676621
Sequence TGTCCCTGCTTTGCAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112356210_1112356219 12 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356219 13:98676634-98676656 GGGCCCTGGGACAGGTGGTCTGG No data
1112356210_1112356214 -2 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356214 13:98676620-98676642 CATGTGTGTCAACCGGGCCCTGG No data
1112356210_1112356212 -9 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356212 13:98676613-98676635 GCAGGGACATGTGTGTCAACCGG No data
1112356210_1112356216 4 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356216 13:98676626-98676648 TGTCAACCGGGCCCTGGGACAGG No data
1112356210_1112356215 -1 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356215 13:98676621-98676643 ATGTGTGTCAACCGGGCCCTGGG No data
1112356210_1112356217 7 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356217 13:98676629-98676651 CAACCGGGCCCTGGGACAGGTGG No data
1112356210_1112356220 13 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356220 13:98676635-98676657 GGCCCTGGGACAGGTGGTCTGGG No data
1112356210_1112356213 -8 Left 1112356210 13:98676599-98676621 CCAGCCACTGCAAAGCAGGGACA No data
Right 1112356213 13:98676614-98676636 CAGGGACATGTGTGTCAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112356210 Original CRISPR TGTCCCTGCTTTGCAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr