ID: 1112356510

View in Genome Browser
Species Human (GRCh38)
Location 13:98678408-98678430
Sequence CGCTTGAACCCGAGAGACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112356510_1112356514 9 Left 1112356510 13:98678408-98678430 CCTTCGTCTCTCGGGTTCAAGCG No data
Right 1112356514 13:98678440-98678462 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
1112356510_1112356512 8 Left 1112356510 13:98678408-98678430 CCTTCGTCTCTCGGGTTCAAGCG No data
Right 1112356512 13:98678439-98678461 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
1112356510_1112356516 17 Left 1112356510 13:98678408-98678430 CCTTCGTCTCTCGGGTTCAAGCG No data
Right 1112356516 13:98678448-98678470 TCCTGAGTAGCTGGGATTACAGG 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112356510 Original CRISPR CGCTTGAACCCGAGAGACGA AGG (reversed) Intergenic
No off target data available for this crispr