ID: 1112359590

View in Genome Browser
Species Human (GRCh38)
Location 13:98705451-98705473
Sequence ACAAAAAATGTCTCCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 1, 2: 30, 3: 86, 4: 543}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112359588_1112359590 -10 Left 1112359588 13:98705438-98705460 CCCAGTTGCTACAACAAAAAATG 0: 1
1: 2
2: 31
3: 288
4: 1159
Right 1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG 0: 1
1: 1
2: 30
3: 86
4: 543
1112359586_1112359590 23 Left 1112359586 13:98705405-98705427 CCTGGCTTCTACATGAGATGCCA 0: 1
1: 0
2: 0
3: 3
4: 149
Right 1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG 0: 1
1: 1
2: 30
3: 86
4: 543
1112359587_1112359590 3 Left 1112359587 13:98705425-98705447 CCAGCAGCATACTCCCAGTTGCT 0: 1
1: 0
2: 1
3: 17
4: 141
Right 1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG 0: 1
1: 1
2: 30
3: 86
4: 543
1112359585_1112359590 24 Left 1112359585 13:98705404-98705426 CCCTGGCTTCTACATGAGATGCC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG 0: 1
1: 1
2: 30
3: 86
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112359590 Original CRISPR ACAAAAAATGTCTCCAGAGA TGG Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900805912 1:4768370-4768392 ACAAAAATTACCCCCAGAGAGGG + Intronic
900837465 1:5016468-5016490 ACAAACAATTTTGCCAGAGAGGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
900922555 1:5682809-5682831 ACAAGAGAAGTCTCCAGAGCAGG - Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903710647 1:25321358-25321380 AAAAAAAATGTCTACAGAATCGG + Intronic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904537947 1:31213284-31213306 GCAAAGAATTTCTCCAAAGAAGG + Intronic
905615559 1:39395225-39395247 ACTAAAAATGTCTCCCTGGAAGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906052284 1:42885592-42885614 ACAAAAAAAATCTCCACAAAAGG - Intergenic
906670794 1:47653070-47653092 AAAAAAAAAGCCTCCAGAGCAGG - Intergenic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907869640 1:58431765-58431787 TCAACAAATGTGTCCAAAGAAGG - Intronic
908076088 1:60519636-60519658 ACAATAAATATCACCAAAGAGGG - Intergenic
908839732 1:68266899-68266921 ATACAAAATGTCTCCGGAGATGG + Intergenic
909287996 1:73845261-73845283 AAAAAAAATGTCTCGTGTGATGG + Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910010520 1:82455666-82455688 ACAGAAAAAGTTTCAAGAGAAGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910972702 1:92872608-92872630 TTACATAATGTCTCCAGAGAGGG + Intronic
911186148 1:94906974-94906996 ACAAGAACTGTCAACAGAGAAGG - Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916644529 1:166770005-166770027 AGAAGAAATGGCTCCACAGAGGG + Intergenic
916865001 1:168847014-168847036 GCAAAAAATGTCTCAAGTAATGG + Intergenic
916911946 1:169360211-169360233 ACAAAAAATAAGTCCAGAAATGG + Intronic
918110485 1:181451318-181451340 ACAGGAACTGTCTCCACAGAAGG - Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
918943411 1:191029381-191029403 ACAAAAAATGTAGCCAGGTATGG + Intergenic
918994444 1:191738859-191738881 ACATAAACTTTGTCCAGAGAGGG - Intergenic
919287151 1:195578469-195578491 TCAAAATATGTCAGCAGAGATGG - Intergenic
920593528 1:207245715-207245737 ACATAAACTGTCTCTACAGATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921523649 1:216189768-216189790 ACAAAAAATGTCTGGACTGAGGG + Intronic
922022357 1:221717547-221717569 ACAAAAAATGCATTCAGAAAAGG - Intronic
923034794 1:230278293-230278315 AAAAAAAATGTTTGTAGAGATGG + Intronic
923081769 1:230664031-230664053 ACAAAAAAATTCTCCAGATGTGG + Intronic
923345853 1:233051984-233052006 CCAGAAAATGTCACGAGAGATGG - Intronic
923642091 1:235773681-235773703 ACAAAAAAGATTTACAGAGATGG + Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1063452846 10:6163246-6163268 TAAGAAAATATCTCCAGAGACGG + Intronic
1063470407 10:6280115-6280137 GAAGAGAATGTCTCCAGAGAAGG - Intergenic
1063900341 10:10726374-10726396 ACAAAACATGTCAGCAGAAACGG - Intergenic
1064444719 10:15383197-15383219 ACAAAAAATTTATCCAGATGTGG + Intergenic
1065088414 10:22203928-22203950 ACAAAAGATGTCAACGGAGATGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067051395 10:43023320-43023342 ACATAAAATGATTCCTGAGAGGG - Intergenic
1067815208 10:49469377-49469399 AAAAAAAATGTATGCATAGATGG + Intronic
1068985431 10:63103937-63103959 ACAGAAGATGCCTCCAGCGAGGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069270728 10:66524122-66524144 ATGAAAAATGTTTCCTGAGACGG - Intronic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072643257 10:97230532-97230554 AAAAAAAATTTCTCCAAAGATGG - Intronic
1073159845 10:101383045-101383067 AAAAAAAAAATCTCCAGGGAAGG - Intronic
1073741145 10:106408563-106408585 ACAAAAAATTTTTTCAGAGATGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1074241938 10:111648538-111648560 AGAATAAAAGTATCCAGAGAAGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074424689 10:113340692-113340714 ACATAAAATGTCTGAAAAGAGGG + Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074607459 10:114987864-114987886 ATAAAAAATGTCAGCAGAGCTGG - Intergenic
1075408804 10:122212273-122212295 ACAAAAGATGACTGGAGAGAAGG - Intronic
1075528425 10:123205153-123205175 ACAAAAACTGTTTTCAGAGCAGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076322624 10:129594754-129594776 ACAGATACTGTCCCCAGAGAAGG + Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079612811 11:22454159-22454181 ACAAAAAATGTCTCGGGTGCTGG + Intergenic
1079647263 11:22881072-22881094 ACAAAATAAGACTCCAGAGCTGG - Intergenic
1079960509 11:26917758-26917780 ACAAAGCATGCCACCAGAGAGGG - Intergenic
1080071473 11:28093643-28093665 ACAAAAAATGATTACAGAAAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081868157 11:46371095-46371117 ACAAAAAATGTGTTCAAAGCTGG + Intronic
1082246825 11:49933248-49933270 AGAAAAAATTTCTACATAGATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083665608 11:64272553-64272575 CCAGACACTGTCTCCAGAGAAGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084198819 11:67541828-67541850 ATAAAAAATGTTTTTAGAGATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084340478 11:68496143-68496165 ACAAAAAAATTAGCCAGAGATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085073068 11:73565746-73565768 ATAAAAAATCTTTCCAGGGAAGG + Intronic
1085551841 11:77380880-77380902 ACAAAAATTCTCTCCAGGGCAGG + Intronic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086425769 11:86680998-86681020 ACAAAAAATGTTTGCAGAATAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091335816 11:134764874-134764896 AAAAAATAGGTCCCCAGAGACGG - Intergenic
1091683307 12:2542192-2542214 ATAAAAAATGACTCCAGAAGGGG - Intronic
1091749539 12:3013873-3013895 ATAAAAAATATTTTCAGAGATGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093291427 12:17328110-17328132 ACAAAAAATCTCTACAATGAAGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093769329 12:23001068-23001090 ACAAAAGATGTCTGAGGAGAGGG + Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094464984 12:30743522-30743544 ACAAGAAATGTCTGTAGAGCAGG - Intronic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1096942431 12:55361737-55361759 TCAAAAAATGTTTTTAGAGACGG + Intergenic
1098045515 12:66396564-66396586 TAAAAAAATGTCTCCAAATAAGG - Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100603815 12:96134599-96134621 ATAAAATATGACTCCAGAAAGGG - Intergenic
1100735750 12:97528374-97528396 GGAAACAATGTCTCCAAAGAAGG - Intergenic
1100806443 12:98289846-98289868 ACAAAACAGGTTTCCAGAGCAGG + Intergenic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101799176 12:108005776-108005798 AAAAAAAATGAGCCCAGAGAAGG - Intergenic
1101832594 12:108270983-108271005 AGAAAAAATATATTCAGAGAGGG + Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102706326 12:114884008-114884030 AAAAAAAATCTTTGCAGAGATGG + Intergenic
1103242106 12:119422313-119422335 ACAAAGGATATCTGCAGAGACGG + Intronic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1104338302 12:127922164-127922186 AAAAAAAAAGTCTTCATAGAGGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106385144 13:29277176-29277198 AAAACAAGTGTCTCCAAAGAGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108556269 13:51595881-51595903 CAAAAAAATGCCTCCAGAGAGGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109370463 13:61414797-61414819 GCAAGAAATGTATCCAGATAAGG - Intronic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109718624 13:66248434-66248456 ATAATAAATGTCTTCAGAAAAGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1110804817 13:79742058-79742080 CCAAAAAATTTCTACAGTGAGGG + Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1111301331 13:86354408-86354430 ACAAGAAACTTTTCCAGAGATGG + Intergenic
1111502566 13:89140840-89140862 AAAAAATATCTCTACAGAGATGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112499413 13:99930875-99930897 CAAAAACATGTCACCAGAGAAGG + Intergenic
1112623148 13:101072910-101072932 TTAAAAAATGTCTGCAGTGATGG - Intronic
1112827456 13:103408216-103408238 AAAAATAGTGTCTCCACAGAAGG + Intergenic
1112999724 13:105620099-105620121 ACAAAAAATGTATCCTAATATGG + Intergenic
1113009277 13:105744956-105744978 AAAAAAAATCCCTCCTGAGAAGG + Intergenic
1113058176 13:106291510-106291532 AGAAAAAGAGTGTCCAGAGAGGG + Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115325809 14:32136885-32136907 AAAAAAAATTTCTCCAAAGAAGG - Intronic
1115520003 14:34223934-34223956 AGAAAGAATGTGTCCACAGAAGG + Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116065511 14:39977231-39977253 ACAATAGATTTCTCCTGAGATGG + Intergenic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116548970 14:46209782-46209804 ACAATAACTGTTTCCAAAGAAGG - Intergenic
1117652040 14:57917357-57917379 AAAAAAAATGTAAGCAGAGAGGG - Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1118756559 14:68849148-68849170 ACAAAAAAAGTTTGTAGAGATGG - Intergenic
1118974191 14:70663364-70663386 CCAAAAAATGTCTCTGGAAATGG - Intronic
1119117651 14:72041282-72041304 ACAAGACACATCTCCAGAGAAGG - Intronic
1119465847 14:74857722-74857744 ACAAAAAATATATATAGAGAGGG - Intronic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120167764 14:81219939-81219961 ACATAAAATGGCCTCAGAGAAGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1121132738 14:91463607-91463629 ACAAAAAATTTTTGTAGAGATGG + Intronic
1121139815 14:91531482-91531504 AAAAAAAAGTTCTGCAGAGAAGG - Intergenic
1121951463 14:98174395-98174417 ACAGAATAAGTCTCAAGAGAAGG - Intergenic
1122303033 14:100742532-100742554 ATGAAAAATGTCTCCAAGGATGG - Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1126320145 15:47413244-47413266 ATTGAAAATGTTTCCAGAGATGG - Intronic
1126523656 15:49625086-49625108 AAAAAAAAAGTATCAAGAGAAGG - Intronic
1129060605 15:72857594-72857616 ACAGAAAATGCCTCAAAAGAGGG - Intergenic
1129089151 15:73130418-73130440 ACAAAAAAAGCCTCAACAGAAGG + Intronic
1129368544 15:75072067-75072089 TCAAAAAAAGTCTCTGGAGAGGG - Intronic
1129381733 15:75172119-75172141 AAAAAAAATGTTTGTAGAGAGGG + Intergenic
1129602097 15:77005228-77005250 ACAAAAAATGTAGCCAGGTATGG + Intronic
1129888022 15:79052245-79052267 AAAGAAAGTGTCTCCAGAGAGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130876187 15:88016844-88016866 AAAAAAAATATCCCCAGAGAAGG - Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132113699 15:99120547-99120569 ATATCAATTGTCTCCAGAGAAGG - Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135205142 16:20477287-20477309 AGAAAAAATTTCTGCAGAGCAGG - Intronic
1135213758 16:20546534-20546556 AGAAAAAATTTCTGCAGAGCGGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135552128 16:23406573-23406595 GCAAGAAAAGTCTCCATAGAAGG - Intronic
1135866860 16:26111249-26111271 AAAAAAAATGTTTGTAGAGATGG + Intronic
1136236736 16:28918823-28918845 ACAAAAAAAGTTTTTAGAGATGG + Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137742353 16:50792252-50792274 ACAGAAAATGTCATCACAGAAGG - Intronic
1138855291 16:60683781-60683803 ACAAGAAATAAGTCCAGAGATGG + Intergenic
1139136498 16:64211153-64211175 ACAAATAATGTCTTTGGAGACGG - Intergenic
1140090245 16:71832332-71832354 AAAATAAGTGTCTCCAGAAATGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141026041 16:80549344-80549366 ACTAAAATTGTTACCAGAGAGGG + Intronic
1141051054 16:80764059-80764081 ACAAAAAAAGTCTTTAAAGATGG + Intronic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1141897151 16:86965382-86965404 TCAAACAGTGTCTCCAGAAACGG + Intergenic
1142482761 17:228833-228855 ACAGAAAAAGGGTCCAGAGAGGG - Intronic
1143968220 17:10772471-10772493 CCAAAAAATGGGGCCAGAGATGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144167850 17:12629849-12629871 ACGATAAATGTTTACAGAGAAGG + Intergenic
1144407231 17:14963942-14963964 AAAAAAAATGTTTTCAGATAAGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147225509 17:38973723-38973745 ACAAAAAAAAACTCCAGGGAAGG + Intergenic
1147695099 17:42346046-42346068 AAAAAAAATTTCTGTAGAGATGG + Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1149427381 17:56568596-56568618 ACAAAGAATCTCATCAGAGAAGG + Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150523917 17:65901649-65901671 GATAAAAATGACTCCAGAGAAGG - Intronic
1150671257 17:67200326-67200348 ACAAAAAAGTACTCCAGTGAAGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151860551 17:76758019-76758041 ACAAAAAATGTTCTCAAAGAAGG + Intronic
1152097899 17:78282691-78282713 ACAAAAAAAGTGTTCACAGATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153699955 18:7682882-7682904 ACTAAAAAAGTATCCAGAGTAGG - Intronic
1154214261 18:12404169-12404191 AAAAAAAATGTTTTTAGAGACGG - Intergenic
1154468113 18:14669500-14669522 ACAAAAACTTTCTGTAGAGATGG - Intergenic
1155380919 18:25221000-25221022 ACAATAAATGATTCCAGGGATGG - Intronic
1155713699 18:28913194-28913216 ACATGAGGTGTCTCCAGAGACGG - Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156597793 18:38567266-38567288 ACAAATAACGTCTGAAGAGAGGG + Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157368348 18:47087139-47087161 ACAAAAAACATTACCAGAGAAGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1159673489 18:71252232-71252254 AGAGAAAATGTTTCCACAGAAGG - Intergenic
1161261716 19:3341473-3341495 ACAAGTAATGTGTCCAGTGAGGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161340077 19:3736557-3736579 ACAAAAAATGAACCCAGATAAGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162642769 19:12025064-12025086 ACTGAAAATGTCTTCACAGATGG + Intronic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164285573 19:23813056-23813078 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164317871 19:24110388-24110410 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164461975 19:28456629-28456651 ACAAAAAATTTTTGTAGAGATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1167023569 19:46897331-46897353 ACAAAAAATGCCTCATGAAATGG - Intergenic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168678401 19:58295715-58295737 ACAAAATATGTCGCTAAAGAGGG - Exonic
925613356 2:5722028-5722050 AGAGAAATTGTCTTCAGAGATGG - Intergenic
925960838 2:9013837-9013859 AAAAAGAATATCTCTAGAGAGGG - Intergenic
926280855 2:11444598-11444620 ACAGAAGAAGTCTCCTGAGAAGG - Exonic
926309704 2:11666707-11666729 ACAAAAAGTAAATCCAGAGAAGG + Intronic
928238087 2:29562735-29562757 GCAAAGACTGTCTACAGAGAAGG + Intronic
929296715 2:40256692-40256714 AAAAAAAATGTCTTTAGAGAAGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930377004 2:50580599-50580621 ACAAGAAATGTGTCAAGTGAAGG + Intronic
930419814 2:51135893-51135915 AGTGAATATGTCTCCAGAGATGG + Intergenic
933070243 2:77848059-77848081 ACAAAAAGTGTCTACTCAGAAGG + Intergenic
933085061 2:78045836-78045858 GGGGAAAATGTCTCCAGAGACGG + Intergenic
933449693 2:82431823-82431845 ATAGAAAAAGTCTCTAGAGATGG - Intergenic
935096086 2:99945629-99945651 ACATACAATTTCTCCAGTGAGGG - Intronic
936597224 2:113859888-113859910 AAAAAAAATGTGGCCAGGGACGG + Intergenic
936684425 2:114811369-114811391 GCAAAAACTGTGTGCAGAGATGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939024477 2:136995578-136995600 CCAAAAAATGTCCCCTTAGATGG - Intronic
939295145 2:140253617-140253639 TTAAAAAATATGTCCAGAGATGG + Intronic
939862863 2:147440318-147440340 ACACAAAAAGTCTCTAGGGAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940610242 2:155980765-155980787 ACAAAACAAGTCACCAGTGATGG + Intergenic
940742968 2:157533005-157533027 AGAAAAAATGTCAACAGATATGG + Exonic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941849411 2:170164054-170164076 AAAAAATATCTTTCCAGAGATGG - Intergenic
942124198 2:172807027-172807049 AAAAAAAATGTTTCCAATGATGG - Intronic
943105256 2:183538459-183538481 TCAAAAAATGGCTCCAAAGAAGG - Intergenic
943568413 2:189543647-189543669 AAAAAAAATCTGTCCACAGAAGG + Intergenic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
944204791 2:197146264-197146286 GTAAAAAATGTCTTCAGGGAAGG - Intronic
944344369 2:198643395-198643417 AAAAAAAAATTCTCCAGAGTAGG - Intergenic
944507999 2:200434231-200434253 ACAAAAACTGTCAGCAAAGAAGG + Intronic
945445866 2:209937732-209937754 CCAACTACTGTCTCCAGAGAGGG - Intronic
945505156 2:210630809-210630831 ACAAATAATTTCTCCACTGATGG + Intronic
945557066 2:211290588-211290610 ACAATAATTGTCTCCAGGAAAGG - Intergenic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946341472 2:219072012-219072034 ACAAAAAAAGTCTCAGAAGATGG + Intergenic
946864360 2:224029682-224029704 ACAAAAAATGTCTATACAGTAGG - Intronic
946962360 2:224998472-224998494 ACAGAGATTGTTTCCAGAGAAGG - Intronic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948549891 2:238764267-238764289 AAAAAAAATTTTTGCAGAGATGG + Intergenic
1168959932 20:1862052-1862074 ACAAAAATAGGCTCCAGTGATGG + Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169560967 20:6800348-6800370 ACATAAACTGTCTGCAGAAAAGG + Intergenic
1169732613 20:8802509-8802531 AAAAAAAATGTTTCCAAAGTGGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170798606 20:19571514-19571536 CTGAAAAATTTCTCCAGAGATGG + Intronic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172859447 20:38035745-38035767 AAAAAAAATGACACCTGAGATGG - Intronic
1173705209 20:45105162-45105184 ACAAGAAATGTTTCTATAGATGG - Intergenic
1174427533 20:50443171-50443193 ACAGAAAAAGTCTGCAGATATGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1176664335 21:9670612-9670634 GCAAAAAGTGACCCCAGAGAAGG - Intergenic
1176806403 21:13488149-13488171 ACAAAAACTTTCTGTAGAGATGG + Intergenic
1176982895 21:15403772-15403794 TCAAGAAAAGTCCCCAGAGAAGG - Intergenic
1177941265 21:27414560-27414582 ACAAAAAATGTGGTGAGAGAAGG - Intergenic
1178418240 21:32421461-32421483 AAAAATAATGTCTCTTGAGATGG + Intronic
1178587230 21:33880696-33880718 ACAAATACTCTCTTCAGAGAGGG + Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1180210033 21:46290072-46290094 ACAAAAACTGTCACTAAAGATGG - Intronic
1180238709 21:46483344-46483366 AAAAAAAAAGTCTGAAGAGATGG + Intronic
1180289231 22:10781746-10781768 ACAAAAAATTTTTCCAAATATGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182082945 22:27542242-27542264 CCAAAAAATGGTTCCACAGAGGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183460007 22:37944158-37944180 ACTTAATCTGTCTCCAGAGACGG - Exonic
1183518548 22:38282726-38282748 ACAAAAACAGGCTACAGAGAAGG + Intergenic
1183564318 22:38602321-38602343 ACTAGAAATGTCTTCAGAGCTGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184053105 22:42023480-42023502 ACAAAAAAGGCTGCCAGAGATGG - Intronic
1184632890 22:45799230-45799252 ATAAAAAATGTTTCCTGGGACGG - Intronic
951407762 3:22322259-22322281 ACAAAAATTTTCTTCACAGAGGG + Intronic
951826050 3:26870185-26870207 AGAAAAAATTTCTGCAGATAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
952252552 3:31668892-31668914 AAAAAAAAAATCTCTAGAGATGG - Intronic
952609917 3:35196045-35196067 AAAAAAAATGTTTCCAGGTAAGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953619895 3:44524139-44524161 AAAAAAAAGGTCTGAAGAGATGG - Intergenic
953734226 3:45477535-45477557 ACAAAGATTGTCCCCAGGGAGGG + Intronic
954690664 3:52394023-52394045 ACAAAGACTGTCCCCAGGGACGG + Intronic
955031465 3:55225448-55225470 AAAAAAACTGTTACCAGAGAGGG - Intergenic
955288369 3:57667325-57667347 AAAAAAAATTTCACTAGAGATGG + Intronic
955443710 3:58984681-58984703 AAACAAAATCTCTACAGAGAAGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955775570 3:62428812-62428834 GAAGAAAATGTCTCCAGATATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957208631 3:77231719-77231741 ACAAAATAACACTCCAGAGAAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957648923 3:82973851-82973873 ACAAGCAAAGTCTGCAGAGATGG + Intergenic
958100632 3:89004840-89004862 ACAAAATATTTCTCCATAGCAGG + Intergenic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
959502411 3:107121522-107121544 GCATAAAATGTCTAAAGAGAGGG - Intergenic
959776335 3:110168449-110168471 ATAAAAAATTTTCCCAGAGAAGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960414922 3:117372731-117372753 AAAAAAAATTTCTCCAGAACTGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960890147 3:122439358-122439380 AAAAAAAATGTTTTTAGAGATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962303625 3:134266506-134266528 AGAAAAAATGACTCCAGGGCTGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962787464 3:138781442-138781464 AAAAAAAATTTCTGTAGAGATGG - Intronic
963721198 3:148864228-148864250 ACTAAACATCCCTCCAGAGATGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964303031 3:155310139-155310161 AAAAAAAAAGTCTCCTGAGGGGG + Intergenic
964473271 3:157076495-157076517 AGAGAAAACATCTCCAGAGAAGG + Intergenic
965435558 3:168646601-168646623 ACAAAAAATATCCCCACTGAAGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967238142 3:187408376-187408398 CCAAAAAATGTAGCCAGAGTTGG - Intergenic
967515021 3:190357930-190357952 ACAAACAATCTCTCCTGTGAAGG - Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
968409972 4:381933-381955 AAAAAAAAAGTTCCCAGAGATGG - Intronic
968796140 4:2706033-2706055 AAAAAAAATATCTGTAGAGATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969271069 4:6102709-6102731 AAAAAAAAAGTCTTTAGAGAGGG - Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970434999 4:16024660-16024682 ACACAAATTGTCTTTAGAGAAGG - Intronic
970695889 4:18676638-18676660 AAAAAAATTGTCTTCACAGAGGG - Intergenic
971049735 4:22847984-22848006 ACAAAAAAGGTCCACAGAAAGGG + Intergenic
971124899 4:23742774-23742796 AAAATAAATGTCTTAAGAGATGG + Intergenic
971580611 4:28334744-28334766 ACAAAAAAGGTCTCTAAGGAAGG + Intergenic
972364720 4:38363626-38363648 ACAAAATATGTCTCGAAAAAGGG - Intergenic
972426093 4:38934376-38934398 CCAAAAATTGTCTGCAGAAAGGG - Intronic
972768184 4:42170984-42171006 ACAATAAAAATATCCAGAGATGG + Intergenic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
974636195 4:64566820-64566842 ACTGAAAATGTCTTCACAGATGG + Intergenic
975748556 4:77498544-77498566 AAAGTAAATGTCTCCAGAAAGGG - Intergenic
975761586 4:77625481-77625503 TCATAACATGGCTCCAGAGAAGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977079897 4:92511904-92511926 AAATAAAAAGTCTCTAGAGAGGG - Intronic
977190368 4:93992640-93992662 ACAAAGGATGTCTCCTTAGATGG - Intergenic
978299672 4:107253020-107253042 AGATAAAATGTCTTCAGAGATGG + Intronic
978988377 4:115045625-115045647 ATGAAAAAGGTCTCCAGGGATGG - Intronic
979128973 4:117015467-117015489 ACAAAAAATGTTTCTAAAGGGGG + Intergenic
979971904 4:127145916-127145938 AAAAAAAAAGTGTCCAGAAAAGG + Intergenic
980646390 4:135647412-135647434 ACATAAAATGTCACCATTGATGG - Intergenic
981204277 4:142020386-142020408 ACAGAATATGTCGACAGAGATGG + Intergenic
981817902 4:148852031-148852053 ATAAAATATGTTTCCAGGGAAGG + Intergenic
982186845 4:152811151-152811173 AAGAACAATGTCTCCAGAGTGGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984059857 4:174978133-174978155 CCAAAAACTGTATCCAGAAAAGG + Exonic
984265121 4:177488998-177489020 AGAAAAATTGTTTCCAGCGAGGG + Intergenic
984279007 4:177644801-177644823 AGAAAAAATTCCTCCAGATAAGG - Intergenic
984310197 4:178048598-178048620 ACAAAATATTTTTCCACAGAGGG + Intergenic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984820589 4:183878218-183878240 TCTAAAAATGTCTCCAGCAAGGG - Intronic
985031323 4:185793697-185793719 ATAAAAAAAATCCCCAGAGATGG - Intronic
985172028 4:187160792-187160814 ACAACAAATGTCAAAAGAGAAGG - Intergenic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985384344 4:189429561-189429583 AGAAAAAAAGTCTCTACAGAGGG + Intergenic
985409799 4:189671291-189671313 GCAAAAATTGACCCCAGAGAAGG - Intergenic
985879422 5:2627410-2627432 ACACCAGATGTCTCCAGAGCCGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987964028 5:24849058-24849080 AAAAAAAATGTATGAAGAGATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990352226 5:54930358-54930380 CCAAAAAATGTCTACAGATTGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991539896 5:67716006-67716028 AAAAAAAATTTTTACAGAGATGG - Intergenic
991581366 5:68158563-68158585 AAAAAAAATGTTTTTAGAGAAGG - Intergenic
992483101 5:77170410-77170432 ACAACAAAAGTCTACACAGAGGG + Intergenic
992517378 5:77508719-77508741 ACAAAAACAAGCTCCAGAGAAGG - Intronic
992646142 5:78813028-78813050 ACAAATTATGTGTACAGAGATGG + Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993509202 5:88750376-88750398 AAAAAAAATGTTTGTAGAGATGG + Intronic
994040402 5:95252813-95252835 ACAAAAAAAGTATCTAGATAGGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994318889 5:98366425-98366447 AAAAAAAATTTATTCAGAGAGGG - Intergenic
994364934 5:98903210-98903232 ACAATAATGGTCTCCAGTGAGGG - Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997077654 5:130699384-130699406 ACAAAAAAAGCCTCCAGCAACGG + Intergenic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998228256 5:140343256-140343278 ACAAAAATTGCTTCTAGAGAAGG + Intronic
998872845 5:146569795-146569817 AGATAAGATGGCTCCAGAGATGG - Intergenic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
999588443 5:153117402-153117424 ACAAAAAATGGCTCCAGTATGGG - Intergenic
1000867597 5:166534159-166534181 ACAAAACATGTTTCCAGGGCTGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1002705291 5:181157166-181157188 AAAAAAAATATCTCCATTGAAGG + Intergenic
1003563282 6:7201672-7201694 ACAAAATCTGTCTCCACTGAAGG - Intronic
1003808642 6:9754862-9754884 AAAAAAAACATCTCCATAGATGG + Intronic
1003889173 6:10548751-10548773 AAAAAAAAGGTCTCCAAATATGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004329197 6:14706278-14706300 AGAAAAGATGTAACCAGAGAAGG + Intergenic
1004330283 6:14714757-14714779 ACAGAAAAATTCTCCAAAGAGGG - Intergenic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006415653 6:33902368-33902390 CCATAACATGTTTCCAGAGAAGG + Intergenic
1006710533 6:36065402-36065424 AAAAAAAATGTATACACAGAGGG + Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007130571 6:39469538-39469560 AAAAAAAATGTTACTAGAGATGG + Intronic
1007535987 6:42589139-42589161 ATAAAAAATTTTTGCAGAGATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007753895 6:44086389-44086411 AAAAAAAATGTTTTTAGAGATGG - Intergenic
1007994886 6:46296368-46296390 TCAAAATATGTCACCAGGGAAGG - Intronic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1008202384 6:48606955-48606977 AGATAAAATGTATCCAGAAATGG - Intergenic
1008277025 6:49553624-49553646 CCAGAAATTGCCTCCAGAGAAGG - Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009256303 6:61406725-61406747 GAAAAAATTGTCTCCAAAGAAGG - Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010327462 6:74581562-74581584 AGAAAAAATGGCTTCAAAGATGG + Intergenic
1011167399 6:84464383-84464405 ACAAAAAAGCTTTCCAGAGGAGG - Intergenic
1011888961 6:92132800-92132822 AAGAAAAATGTTTCCAGGGAAGG + Intergenic
1012030506 6:94054549-94054571 GCAAAACATTTCTTCAGAGAGGG + Intergenic
1012304634 6:97638115-97638137 ACAAAAGATTTCTCCACAGCAGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014635979 6:123847190-123847212 GATAAAAATGTCTTCAGAGATGG - Intronic
1014707850 6:124770021-124770043 ACAGAATCTGTCTCTAGAGAGGG - Intronic
1015095856 6:129415255-129415277 GAATAAAATGTCTTCAGAGAAGG - Intronic
1015329429 6:131960015-131960037 AAAAAAAATCTCTCCTGAAATGG - Intergenic
1015391337 6:132685830-132685852 ACGGAGAATGTTTCCAGAGAGGG + Intronic
1016882102 6:148921594-148921616 CCAAAGGATGGCTCCAGAGAGGG - Intronic
1016913849 6:149226240-149226262 ACAGAAAATAGCTCCAGTGAAGG + Intronic
1017292321 6:152753591-152753613 TCAAAGAATGTCTCCATAGATGG - Intronic
1017455584 6:154598184-154598206 ACAAAGTAATTCTCCAGAGAAGG + Intergenic
1018115401 6:160578719-160578741 ACAACACAGGTCACCAGAGATGG + Intronic
1018116959 6:160595550-160595572 ACAACACAGGTCACCAGAGATGG + Intronic
1018479709 6:164178000-164178022 ATAAAAAATGTATTCAGTGAAGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020401168 7:7779439-7779461 ACAAAAAAAGTTTCTACAGATGG + Intronic
1021251599 7:18334380-18334402 AAAAAACATCTCACCAGAGATGG + Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021769154 7:23981167-23981189 ACAAAAATTGTTTCTGGAGATGG + Intergenic
1022170222 7:27820308-27820330 ACAAAAAATGTCTGCAGTTTAGG - Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022354419 7:29599132-29599154 TCAAAAAGGGTCTACAGAGAAGG - Intergenic
1024477574 7:49829869-49829891 AGATAAAGAGTCTCCAGAGATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026003960 7:66585839-66585861 ACAATAAATATCTGCAAAGATGG - Intergenic
1026027214 7:66755317-66755339 ACAAAAAATTTAGCCAGGGATGG + Intronic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1027298316 7:76802032-76802054 AAAAAAAAAGTTTCCAGTGATGG - Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027743260 7:82039870-82039892 ACATAAAATGAGTTCAGAGAGGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030497873 7:110321845-110321867 AGAAAAAATGTATGAAGAGATGG + Intergenic
1030742200 7:113123152-113123174 ACAATAAATGTCTACATAAAAGG - Intergenic
1031421762 7:121561298-121561320 CCAAAAAAAGTGTCCAGGGAAGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032161918 7:129517358-129517380 AGAAAAAATGTCCACAGAGGAGG + Intergenic
1033037819 7:137891559-137891581 AGAAAGTATGTCTACAGAGAGGG - Intronic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1033564890 7:142569042-142569064 AAAAAAAATTTCACCAGTGAAGG - Intergenic
1034547641 7:151799529-151799551 ACAATAAATGACACCAGAAAGGG - Intronic
1035170708 7:157015828-157015850 AGAGAAAAAGACTCCAGAGAAGG - Intergenic
1035347760 7:158216596-158216618 AAAGAAAATGGCTACAGAGAAGG + Intronic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036919603 8:12838973-12838995 AGAAAAAAGGTATACAGAGAGGG - Intergenic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038627442 8:29207695-29207717 AAAAAAAATGCTTTCAGAGATGG + Intronic
1039549458 8:38432396-38432418 AAAAAAAATTTATCCCGAGATGG - Intronic
1040938498 8:52807318-52807340 AAAAAAAATTTCTGTAGAGATGG + Intergenic
1041267990 8:56083614-56083636 ATAACAAATGTCTACAGAGGAGG + Intergenic
1042090486 8:65153946-65153968 ACAGAAAAATTCCCCAGAGATGG + Intergenic
1043403202 8:79903890-79903912 ACAACGAATGTGTCCAGGGATGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1045465719 8:102468105-102468127 ACAAAAAAATTATCCAGGGATGG - Intergenic
1045686083 8:104713739-104713761 AAAAAAAATTCCTCCAGAGTGGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045969741 8:108066169-108066191 ACAAGTAATGTCACCTGAGAAGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046279920 8:112013454-112013476 TAAAAAAATGTTTACAGAGAAGG + Intergenic
1047451269 8:124967034-124967056 ATAAAAAATGTCTGAAAAGATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048094808 8:131280169-131280191 ACAAATAATGGCTCAAGAAATGG - Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051147792 9:14047319-14047341 ACAGAATATGTGACCAGAGATGG + Intergenic
1051680395 9:19601565-19601587 AGTAAAAATGTATCCAGAGTTGG - Intronic
1051990573 9:23147094-23147116 AAAAAAAATCTGTCCAGATATGG - Intergenic
1052294959 9:26887246-26887268 ACAAAAAATTGCTACAAAGAAGG + Intronic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052541901 9:29822396-29822418 ACAAAAAATAACTACAAAGAAGG + Intergenic
1052651101 9:31302353-31302375 ACAAACAATGTATCCAATGAAGG + Intergenic
1055330714 9:75180365-75180387 ACAAAAAAAATCTCCATAAATGG - Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1055777962 9:79786790-79786812 CCAAAGCATGTCTCCACAGAGGG + Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1056833915 9:89939244-89939266 ACAACAAATGACTTCAGAAAGGG - Intergenic
1056911960 9:90709208-90709230 ACAAGGCATGTCTTCAGAGAAGG + Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058580221 9:106447766-106447788 ACAAAATATGTGTTCATAGATGG + Intergenic
1059716371 9:116916979-116917001 AAAAAAAAAATCTCCATAGAGGG - Intronic
1059848068 9:118303611-118303633 TCTAAAAATGTAGCCAGAGATGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060078780 9:120621039-120621061 AAAAAAAATGTTTCCAAGGAAGG + Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1203661766 Un_KI270753v1:51140-51162 GCAAAAAGTGACCCCAGAGAAGG + Intergenic
1203672957 Un_KI270755v1:34189-34211 GCAAAAATTGACCCCAGAGAAGG + Intergenic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185819255 X:3185864-3185886 TCACAAAATGTGTCCAGAGTTGG + Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1185929659 X:4188141-4188163 AGAAAAAAACTTTCCAGAGATGG - Intergenic
1185942973 X:4341716-4341738 AGTAAAAATGGTTCCAGAGAAGG + Intergenic
1186113420 X:6279175-6279197 ATAAAACATGTCTCCAGTGCAGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186247030 X:7625417-7625439 AAAAGAGATGTCTTCAGAGAAGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186639564 X:11441049-11441071 ACAAACCATATCTCCAGAAAAGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188406745 X:29820562-29820584 ACTTAAAATGTCCCCAGAGGGGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189327920 X:40124261-40124283 AAAAAAAATGTATATAGAGATGG - Intronic
1189448651 X:41106026-41106048 ACAAATAATGTATCCAGTAAGGG - Intronic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1190935265 X:54993992-54994014 TCCTAAGATGTCTCCAGAGATGG - Exonic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1193837916 X:86368732-86368754 ACAAAAAAATTCTGCAGAGAAGG + Intronic
1194428181 X:93765357-93765379 ACAAAAAAGCTATCCAAAGACGG - Intergenic
1194606830 X:95991008-95991030 CCAAAAAATGTATAAAGAGAAGG - Intergenic
1195351377 X:103999821-103999843 ACAGCAAATGACTCCTGAGACGG + Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196681502 X:118474528-118474550 GCTGAAAATGTCTCCAGAGTGGG - Intergenic
1197518733 X:127471719-127471741 TCAAATATTGTCTCCAGAGATGG - Intergenic
1198195947 X:134362317-134362339 AAATAAAATGTCACCAGAAAAGG - Intergenic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1198603423 X:138310130-138310152 AGAAAACATGTGCCCAGAGAAGG - Intergenic
1198735284 X:139778025-139778047 AAAAAAAATTTCTGTAGAGATGG + Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199290791 X:146102846-146102868 ACCAAAAACGTAGCCAGAGAAGG - Intergenic
1201079035 Y:10216292-10216314 ACAAATAATATCTAGAGAGAAGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1201727880 Y:17173507-17173529 AGTAAAAATTGCTCCAGAGAAGG + Intergenic
1201754591 Y:17472415-17472437 AGAAGAAATGTCTACAGAAACGG - Intergenic
1201791350 Y:17844021-17844043 AGAAGAAATGTTTACAGAGATGG - Intergenic
1201810204 Y:18061968-18061990 AGAAGAAATGTTTACAGAGATGG + Intergenic
1201846961 Y:18433570-18433592 AGAAGAAATGTCTACAGAAACGG + Intergenic
1202352963 Y:24013669-24013691 AGAAGAAATGTTTACAGAGATGG - Intergenic
1202517816 Y:25656446-25656468 AGAAGAAATGTTTACAGAGATGG + Intergenic