ID: 1112362020

View in Genome Browser
Species Human (GRCh38)
Location 13:98727046-98727068
Sequence TTTCTTTTAAGAAGCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 435}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112362009_1112362020 28 Left 1112362009 13:98726995-98727017 CCCGGCCCCAGACTCATGCTTCT 0: 1
1: 0
2: 1
3: 40
4: 379
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362011_1112362020 23 Left 1112362011 13:98727000-98727022 CCCCAGACTCATGCTTCTTATCT 0: 1
1: 0
2: 0
3: 21
4: 303
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362012_1112362020 22 Left 1112362012 13:98727001-98727023 CCCAGACTCATGCTTCTTATCTG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362019_1112362020 -9 Left 1112362019 13:98727032-98727054 CCTGGCATCTGTATTTTCTTTTA 0: 1
1: 0
2: 11
3: 125
4: 1119
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362013_1112362020 21 Left 1112362013 13:98727002-98727024 CCAGACTCATGCTTCTTATCTGA 0: 1
1: 1
2: 0
3: 18
4: 184
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362010_1112362020 27 Left 1112362010 13:98726996-98727018 CCGGCCCCAGACTCATGCTTCTT 0: 1
1: 0
2: 5
3: 30
4: 398
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112362020 Original CRISPR TTTCTTTTAAGAAGCTCCTC AGG Intronic
900732647 1:4272332-4272354 TTTCATCCAAGAAGCCCCTCCGG - Intergenic
900847227 1:5113595-5113617 TTTCTTTTTTCATGCTCCTCTGG + Intergenic
904098137 1:27998225-27998247 CCACTTTTAAGAAGCTCCCCAGG + Intronic
905483660 1:38280159-38280181 ACTCTTTCAAGAAGCTCGTCTGG - Intergenic
905937886 1:41839299-41839321 TTCCTTTGAAGAAGAGCCTCTGG + Intronic
906233134 1:44182782-44182804 TTTCTTTTAAAAAGCCTCTCTGG - Intergenic
908116598 1:60946923-60946945 TTGCTTTTAAAAATCTCATCTGG - Intronic
908474938 1:64478232-64478254 CTTCTTTGGGGAAGCTCCTCTGG + Intronic
908673881 1:66579175-66579197 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
908674059 1:66581911-66581933 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
908776731 1:67647817-67647839 ATACTTTTTAGAAGCTCTTCAGG - Intergenic
908959633 1:69680218-69680240 TGTATTTTAAGAAGCTCTGCAGG + Intronic
909550054 1:76888238-76888260 TGCATTTTAAGAAGCTTCTCCGG - Intronic
909872937 1:80766308-80766330 TTTCATTTAACAAGCTACCCTGG + Intergenic
910337740 1:86154509-86154531 TTTTTCTTCAGAAGTTCCTCCGG + Intronic
911594683 1:99786756-99786778 ATCCTTTTAAGGAGCTCATCGGG + Intergenic
913617181 1:120572659-120572681 TTTCTTTTAAGGGGCTCATTAGG - Intergenic
914336152 1:146716643-146716665 TTTATTTTAAGGAGCTTCCCGGG + Intergenic
914573095 1:148938255-148938277 TTTCTTTTAAGGGGCTCATTAGG + Intronic
915194770 1:154181369-154181391 TTTCTTTTTGGCTGCTCCTCTGG - Intronic
917212927 1:172648257-172648279 TTTCTTTCAGGAGGCTCATCAGG - Intergenic
918387268 1:184022301-184022323 TTTCTTTTTAGTGACTCCTCTGG + Intronic
918686072 1:187417529-187417551 TATCTTGAAAGAAGCTCATCTGG - Intergenic
920000177 1:202792337-202792359 TGAATTTTAAAAAGCTCCTCCGG - Intronic
920078002 1:203350980-203351002 TTTCTTTTAAGGAACTGCTAGGG + Intronic
921684484 1:218074390-218074412 TTTTTTTAAAAAAGCTCCCCAGG - Intergenic
922311729 1:224399736-224399758 TTTCTTTTATTAAGCTCGTTTGG - Intronic
922627377 1:227062352-227062374 TTTCCTTTAATAAGCTTTTCTGG + Intronic
923944522 1:238868770-238868792 TTTCTTTTCAGAAGTTAGTCTGG + Intergenic
924097507 1:240568509-240568531 TTTCTTTTAAGGAGCTGTTTAGG - Intronic
924234568 1:241990080-241990102 TTTTTTTTAAGCATCTACTCAGG - Intergenic
1062809372 10:450731-450753 TTTCTCTTGGGAAGCTCTTCTGG - Intronic
1063110281 10:3029664-3029686 TTCCTTGTAAGATGCTGCTCCGG + Intergenic
1063261226 10:4391783-4391805 TCTCATTTAACAAGATCCTCAGG - Intergenic
1064991570 10:21261259-21261281 TTTCTTTTTAGAGACTCTTCTGG - Intergenic
1065225674 10:23541629-23541651 ATTCTTTTAAAAAGTTCCTTTGG - Intergenic
1067743761 10:48916829-48916851 TTACTTTTAAAAAGCACCTAGGG - Intronic
1070053926 10:72915978-72916000 TCTCTTCTATGAAGCCCCTCAGG - Intronic
1070170358 10:73928220-73928242 TGTGTTTTAACAAGCTCCCCAGG + Intergenic
1070407644 10:76111268-76111290 CTTCCTTAAATAAGCTCCTCAGG + Intronic
1070506063 10:77113984-77114006 TTTCTGTTAAGAATCTCTTCGGG + Intronic
1071253382 10:83843282-83843304 TTTTGTTTGAGAAGCTCCTGTGG + Intergenic
1071259679 10:83908628-83908650 TTTCTTTTAAGCACTTCCTTTGG + Intergenic
1071721603 10:88152210-88152232 TTTCTTTGAAGAACCACCCCAGG - Intergenic
1071784870 10:88887825-88887847 TTCCTTTTAACAATCTTCTCAGG + Intronic
1071853232 10:89597050-89597072 TTATTTTTAAGAAGCTACACAGG - Intronic
1072179309 10:92965273-92965295 TATGTTTTAAAAAGTTCCTCAGG + Intronic
1072516819 10:96191801-96191823 TTCTTTTTAAGAAGCTCATGTGG - Exonic
1072583207 10:96758407-96758429 TATATTTTAACCAGCTCCTCTGG - Intergenic
1072608225 10:97000947-97000969 TTGCTTTTAAAAGGCTGCTCTGG + Exonic
1072621357 10:97081543-97081565 TTTCTTCTGAGAAACTCCTGAGG - Intronic
1072952454 10:99859754-99859776 TCTATTTTAACAAGATCCTCAGG - Intergenic
1073972898 10:109064542-109064564 TTTCTTTAGAAAAGCTGCTCTGG - Intergenic
1074207005 10:111291334-111291356 TTTTTTTTTACAAGCTCCCCAGG - Intergenic
1074329593 10:112492027-112492049 ATTGTTTTAAAAAGCTCCCCAGG + Intronic
1075643373 10:124081472-124081494 TTTCTTTCAATAAGCTCCGTGGG + Intronic
1075691600 10:124399310-124399332 ATTTTTTTAAGAAGCTCCCCAGG + Intronic
1076032747 10:127173399-127173421 TTGCTTTAAATAAGATCCTCAGG - Intronic
1078639323 11:13080535-13080557 TATTTTTTAAGAAGCTCCTCTGG + Intergenic
1080899738 11:36478221-36478243 TGCATTTTAATAAGCTCCTCAGG + Intergenic
1081695088 11:45104238-45104260 TTTCTTGAGAGAAGTTCCTCTGG - Intronic
1081828929 11:46089510-46089532 TTTCTTTTATGACACTCCACAGG + Intronic
1082998681 11:59272650-59272672 TTTCTTTTAAGAAACTGTTCCGG - Intergenic
1083169651 11:60915466-60915488 TTTGTTTTGCAAAGCTCCTCAGG - Intronic
1083191710 11:61056999-61057021 TTTCTTATTTGAAGCTCCCCAGG + Intergenic
1084235441 11:67785303-67785325 TTTCTTTAAAGAGACACCTCTGG + Intergenic
1084501159 11:69536225-69536247 AGTCTTGTGAGAAGCTCCTCGGG + Intergenic
1085075797 11:73590783-73590805 TTTTTTTTAAACAGCTCCTCGGG + Intronic
1086004653 11:82024213-82024235 TGTCTTTTAAGATACTGCTCAGG - Intergenic
1086924913 11:92629881-92629903 TGTATTTTAATAGGCTCCTCTGG - Intronic
1087040740 11:93797041-93797063 TTGTTTTTAAAAAGCTCCTTAGG + Intronic
1087235049 11:95708785-95708807 TTTCTTTTAAAAAGCTGCAATGG + Intergenic
1089239276 11:117061686-117061708 TTCATTTTAATAAGATCCTCAGG + Intronic
1090360644 11:126170266-126170288 TGTCGTTTAAGAACCTGCTCAGG + Intergenic
1091659310 12:2371455-2371477 ACTGTTTTAACAAGCTCCTCAGG - Intronic
1092281706 12:7102350-7102372 CTTCTTTTAAGAAGTTCCTTGGG + Intronic
1092403666 12:8199268-8199290 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1093562458 12:20558370-20558392 TTGCTTTTTAGAACCACCTCAGG - Intronic
1093563363 12:20570991-20571013 TTCCTTTTAAGAAGTTTCCCAGG + Intronic
1093883114 12:24428469-24428491 TTTCTTTTAAAAAGCTAATTTGG + Intergenic
1094450189 12:30575996-30576018 TACCTTTTAATAAGCTCTTCTGG - Intergenic
1094727079 12:33131270-33131292 TTTTGTCTAAGAAGCTGCTCTGG + Intergenic
1095188371 12:39227818-39227840 TTTCTTTTAAAAAGTTCTTTAGG + Intergenic
1095709221 12:45270221-45270243 ATTCTTTTTAGAAGGTGCTCAGG + Intronic
1095935901 12:47680828-47680850 TTTTTTTTAAAAAACTCTTCGGG - Intronic
1096197159 12:49656103-49656125 GTACTTTTAACAAGCTCCTTAGG + Intronic
1096938467 12:55311801-55311823 TTTCTTTCAAGAAGATCCGCTGG - Intergenic
1097733408 12:63154237-63154259 TTTCTTTTCTGAAGTTTCTCAGG - Intergenic
1098637583 12:72803121-72803143 TTTATTGTAAATAGCTCCTCCGG - Intergenic
1099411117 12:82329394-82329416 TTTTTTTTTTGAAGCTCTTCAGG + Intronic
1099558474 12:84142220-84142242 TTTCTTTTAAGTAGCTGTTCTGG - Intergenic
1099987110 12:89679446-89679468 TTGATTTTAAAAAGCTCCTGTGG + Intronic
1100441452 12:94621056-94621078 TATTTTTTAACAAGCTCCACAGG + Intronic
1100686854 12:96995958-96995980 TTTCTTTTGATAAGCTACTGAGG - Intergenic
1100971150 12:100071660-100071682 TTTATTTTTAGAAGCTTCTTTGG - Intronic
1101346242 12:103888988-103889010 TTTCTTTTAAGGAGCTTTTCTGG - Intergenic
1101720183 12:107344200-107344222 TTTCTTTTAAGCAGCGTCACTGG + Intronic
1103170334 12:118813127-118813149 TGTATTTTTACAAGCTCCTCTGG - Intergenic
1107303119 13:38986896-38986918 TGTATTTTAAGGAGCTCCCCAGG + Intronic
1107541014 13:41389175-41389197 TTTGTTTTTAAAAGCTCCTCCGG + Intergenic
1108020325 13:46121527-46121549 TGTGTTTTAATAAGCTCCCCAGG + Intergenic
1108271131 13:48760610-48760632 AGTTTTTTAAGAAACTCCTCAGG + Intergenic
1108598347 13:51969239-51969261 TCTATTTTAACAAGGTCCTCGGG - Intronic
1110720377 13:78754592-78754614 TGCCTTTTAACAAGCTCCGCAGG + Intergenic
1110760327 13:79223961-79223983 TCACTTTTAAAGAGCTCCTCTGG + Intergenic
1110963935 13:81666851-81666873 TTTCTTTAAAGAGGCTATTCAGG - Intergenic
1111469581 13:88661041-88661063 TTTGTTTTAAGAATCTCTTCTGG + Intergenic
1111532422 13:89555987-89556009 CTTCATTGATGAAGCTCCTCAGG - Intergenic
1111811571 13:93098316-93098338 GTGCTTTTAAAAAGCTCCTCTGG + Intergenic
1111969137 13:94892514-94892536 TTTCTTTTAACAAAATCATCTGG + Intergenic
1112308389 13:98296022-98296044 ATTCTTTTAAAAAGCTCCCCAGG - Intronic
1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG + Intronic
1112673864 13:101674966-101674988 TTTCTTCTGATAGGCTCCTCTGG + Intronic
1112749131 13:102563941-102563963 TTTTCTGTAAGAAGCTGCTCAGG - Intergenic
1114361530 14:21978872-21978894 TGTCTTTGAAGAAGCCCCTGTGG + Intergenic
1114374800 14:22132780-22132802 TGTCTCTGAAGAAGCCCCTCTGG + Intergenic
1114418973 14:22563894-22563916 TTCATTTTAACAAGGTCCTCCGG - Intergenic
1114799175 14:25753014-25753036 TTTCATTTCAGAATCTCCTATGG - Intergenic
1115056385 14:29132833-29132855 ATTCTTTTAGGAAGCTTCTCTGG + Intergenic
1115153063 14:30307593-30307615 TGTATTTTAATAAGCCCCTCTGG + Intergenic
1115575952 14:34712236-34712258 TTTCTTTTAAGAAGATATGCAGG + Exonic
1116418290 14:44704836-44704858 TTTCTTCTCAGAAGAACCTCTGG - Intergenic
1116734619 14:48672762-48672784 TTTCATTTATGAAGCTTCTTTGG - Intergenic
1116744775 14:48804032-48804054 GTATTTTTAATAAGCTCCTCAGG + Intergenic
1116909650 14:50446545-50446567 TTCCTTTTAATAAGCTCTCCAGG + Intronic
1116993474 14:51299414-51299436 TTTCTTCAAAGAATCTCCACTGG - Intergenic
1117526195 14:56607802-56607824 GTATTTTTAAGAAGCTCCCCAGG + Intronic
1117858097 14:60056773-60056795 TTTCTTTTAACTAGCTGTTCAGG + Intronic
1119858294 14:77917413-77917435 TTTCTTTTAAGACACCCCCCAGG + Intronic
1120078197 14:80184465-80184487 TCTCTTTTAAGGAGGTCCTTGGG - Intergenic
1120395028 14:83957435-83957457 TTTCCTTTAAGCTGCTCTTCAGG + Intergenic
1121228852 14:92341662-92341684 TTTCCTTTAAGAAGCACTTTAGG - Intronic
1121668052 14:95687229-95687251 TTACTTTTCAAAAGCTCCCCAGG + Intronic
1121871878 14:97415763-97415785 TTCCTTTTAAGAAGAACCTGGGG - Intergenic
1122828757 14:104385160-104385182 TTCCTTTTAAGAAATTGCTCAGG - Intergenic
1123112282 14:105878601-105878623 TTTCTTTTCATCAGCTCCACGGG + Intergenic
1124527855 15:30473617-30473639 TTCCTTTTTAAAAGCTCCTAAGG - Intergenic
1124581769 15:30962067-30962089 TTTCCTTTGAAAAGCTCATCAGG + Intronic
1124621023 15:31273970-31273992 TTTCTGTCAAGAGGCTCCCCTGG - Intergenic
1124770803 15:32534085-32534107 TTCCTTTTTAAAAGCTCCTAAGG + Intergenic
1125210598 15:37210503-37210525 TTTCTTTTAAGAAGATCTAGAGG + Intergenic
1125318890 15:38460547-38460569 TTTATTTTAACAAGACCCTCAGG + Intronic
1125990200 15:44099265-44099287 TGTATTTTAACAAGATCCTCAGG - Intronic
1127001631 15:54515145-54515167 GTTTTTTTAAAAAGCACCTCTGG + Intronic
1127696310 15:61451442-61451464 TTTTTTTTAATAAGCTACTGGGG - Intergenic
1127710199 15:61589470-61589492 TTTGTTTGAAGAAGCTCTCCAGG + Intergenic
1129479992 15:75816063-75816085 TATCTTCTGGGAAGCTCCTCTGG - Intergenic
1129497383 15:75997992-75998014 TATCTTTTATGAAGCTTTTCTGG - Intronic
1129616401 15:77101731-77101753 TTCCTTTTGAAAAGCTCCCCTGG + Exonic
1129896692 15:79113688-79113710 TTTCTCTTAAGAAGCCTTTCTGG + Intergenic
1130873064 15:87987112-87987134 TGTGGTTTAATAAGCTCCTCAGG + Intronic
1133347007 16:5077937-5077959 TTTCTTTAAAGAGACACCTCTGG + Exonic
1135928386 16:26715229-26715251 TTTCATTTAAGACCCTTCTCTGG + Intergenic
1136092268 16:27929009-27929031 TTAGTTTTTAAAAGCTCCTCTGG - Intronic
1139997470 16:70994576-70994598 TTTATTTTAAGGAGCTTCCCGGG - Intronic
1143230292 17:5348278-5348300 CTTCTTTTAAGAAGCCTATCTGG - Intronic
1143807122 17:9438446-9438468 TGTCTTTTAACAAGATCCCCAGG + Intronic
1144099222 17:11929466-11929488 TGTATTTTAAGAAGCCCTTCAGG + Intronic
1144378022 17:14665075-14665097 TTTCTTTAAAAAAGCTCTTTGGG + Intergenic
1146027858 17:29338322-29338344 TTATTTTTAAGAAGCAGCTCAGG - Intergenic
1146039758 17:29440462-29440484 TTCCTTTTAATAAGCTCATATGG - Intronic
1146096476 17:29934878-29934900 GTTATTTTAAGTAACTCCTCAGG + Intronic
1148098423 17:45071191-45071213 TTTATTTTAATAAGTTTCTCTGG + Intronic
1148391702 17:47277270-47277292 TTATTTTTAACAAGCACCTCAGG - Intronic
1148676417 17:49448201-49448223 TTCCTTTTAACAAGGTCCCCAGG - Intronic
1149235158 17:54581061-54581083 TTTCTTTTTAGAGGCTTCACTGG - Intergenic
1149464525 17:56866343-56866365 TTTTTATTAACAAGCGCCTCAGG + Exonic
1149720400 17:58837986-58838008 TTTCAATTAAGAAAGTCCTCTGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152499630 17:80699168-80699190 TTTCTCTGGAGAAGCTCATCGGG + Intronic
1153188622 18:2513838-2513860 TTTTTTTTTTGAAGCTTCTCAGG - Intergenic
1153290502 18:3497569-3497591 ATTATTTTAAAAAGCTTCTCTGG + Exonic
1153856857 18:9158103-9158125 TTTATTTTAAAAAGTTTCTCAGG - Intronic
1153925580 18:9832327-9832349 CTTGTTTTCAGAAGCTCATCTGG - Intronic
1154058122 18:11031305-11031327 TTTTTTTTAATAAGCCCATCAGG + Intronic
1156398826 18:36722733-36722755 TATATTTTTAAAAGCTCCTCAGG + Intronic
1157720267 18:49918034-49918056 TTCCTTGTAATGAGCTCCTCAGG + Intronic
1158932747 18:62336982-62337004 TTTCCTTTAAGAAGCACATCTGG + Intronic
1158983225 18:62786103-62786125 TCTCTTTTAGGAAGATGCTCTGG - Intronic
1159274880 18:66205960-66205982 TTTCTTTTCAGAAAATCCTGAGG + Intergenic
1160400469 18:78607237-78607259 CTTCTTTTGAGAAGGTCCTGAGG + Intergenic
1160439113 18:78875568-78875590 TTTCTTTTGAGAAGCCCCACTGG - Intergenic
1162493469 19:11009318-11009340 TTTCTTTTAAAAAGTAACTCTGG - Intronic
1164742910 19:30589964-30589986 TATCTTTAAAGATGATCCTCTGG - Intronic
1164886802 19:31785141-31785163 TTTCTTTTAAAAAAATCCTGTGG - Intergenic
1166495290 19:43298294-43298316 TTTCTTTTAAGCATCACATCAGG + Intergenic
926597386 2:14806083-14806105 TGTGTTTTAACAAGCTCCCCAGG - Intergenic
926808249 2:16733138-16733160 TTGCTTCTAAGAAGCTCTTGGGG - Intergenic
927609395 2:24523202-24523224 TTTGTTTTAAAAAGCTGATCGGG - Intronic
927656936 2:24956786-24956808 TGTATTTTAAGAATTTCCTCAGG + Intronic
927909229 2:26884893-26884915 TTTCTTTTAAAAACCGTCTCAGG + Intronic
927977530 2:27350346-27350368 TGTGTTTTAACAAGCTCTTCAGG + Intronic
928108981 2:28491166-28491188 ATTCTTTTAAAAAGTTCCCCAGG + Intronic
928328980 2:30342727-30342749 TTCATTTTAATAAGCTCCCCAGG + Intergenic
929012869 2:37463342-37463364 TTTCTTTTAAAAAGCTTCCTGGG + Intergenic
930790564 2:55323299-55323321 TTTATTATAAGAATCTCCTAGGG - Intronic
932961548 2:76418251-76418273 TTAGTTTTAAGAAGCTTCCCAGG + Intergenic
933046892 2:77550363-77550385 TGTGTTTTAATAAGCTCTTCAGG - Intronic
933149688 2:78899307-78899329 TTTCTTTTAAAAATCTCCCAGGG - Intergenic
935171391 2:100613559-100613581 TTGCTTGTGAGAAACTCCTCAGG + Intergenic
935791930 2:106600790-106600812 TTTCTATAAAGAAGCTCCCTAGG + Intergenic
937132323 2:119523164-119523186 TCTCTTCCAAGAAGCTCCCCAGG - Intronic
937355925 2:121197991-121198013 TTTATTTTGAGGAACTCCTCTGG - Intergenic
938372357 2:130779354-130779376 TTTCTTTTAAGAATATACTTAGG - Intergenic
939589618 2:144048109-144048131 TTTCTTTTCAGCAGCTAATCTGG - Intronic
940063172 2:149595411-149595433 TATGTTTTAACAAGCTCCTCAGG + Intergenic
940113484 2:150181547-150181569 TGTCTTTTACCATGCTCCTCTGG + Intergenic
940174272 2:150861422-150861444 TTTCTTATACCAAGCTCTTCAGG - Intergenic
940554243 2:155203081-155203103 TTTCTTTAAAGCAGTCCCTCTGG - Intergenic
940588729 2:155691614-155691636 TGTCTTTTAAGATTCTGCTCAGG + Intergenic
940753782 2:157658772-157658794 TGTATTTTAATAAGATCCTCGGG - Intergenic
940837577 2:158541095-158541117 TTTCTTTTTAGAATCACTTCTGG + Intronic
941317143 2:164007595-164007617 CTTTTTTTAAGAAGATACTCAGG + Intergenic
941871660 2:170391996-170392018 TTTTTTTTAATTAGCTACTCGGG + Intronic
941920824 2:170849083-170849105 TTTCTTTTTCAAAGTTCCTCTGG - Intronic
942112766 2:172698866-172698888 TTGTTTCTTAGAAGCTCCTCAGG + Intergenic
942937622 2:181576996-181577018 TATGTTTTAAGAAGCACGTCAGG - Intronic
943035051 2:182733415-182733437 ATTATTTTTAAAAGCTCCTCAGG - Intronic
943745562 2:191458494-191458516 TTTCTTTTTAGAGGTTACTCTGG + Intergenic
943790525 2:191927397-191927419 TTTGTTTCCAGAATCTCCTCTGG + Intergenic
944088511 2:195877209-195877231 TTTATTTTGAAGAGCTCCTCAGG - Intronic
944186062 2:196950047-196950069 CATCTTTTAAGATGCTGCTCAGG + Intergenic
944236114 2:197442749-197442771 ATAATTTTAAGAAGCTCTTCAGG - Intergenic
944442734 2:199758798-199758820 TCTATTTTAACAAGCCCCTCAGG + Intergenic
944609678 2:201389598-201389620 TTTCTCCTAAATAGCTCCTCAGG - Intronic
945675301 2:212849081-212849103 TTTCTTTTATCCAGCTCCGCTGG - Intergenic
945682459 2:212930544-212930566 TTTTTTTTAAGAACATTCTCAGG - Intergenic
946356493 2:219188951-219188973 TATCTTTTAAGATGCACTTCAGG + Intergenic
946666314 2:222053303-222053325 TCTGTTTTAAGAAGCTCCTTGGG - Intergenic
947140465 2:227015441-227015463 TGTGTTTTAACAAGCTCCTCAGG + Intronic
948247730 2:236500590-236500612 TTTCTTATAATAAGCTGGTCTGG - Intronic
948565951 2:238886393-238886415 TTTCATTTATGAAACTTCTCTGG + Intronic
1168801624 20:647077-647099 TTGGTTTTCAGAAGCCCCTCTGG + Exonic
1169327831 20:4690030-4690052 TTGTTTTTTAAAAGCTCCTCAGG + Intronic
1169875246 20:10290149-10290171 TTTCTGTGAAGATGCTTCTCAGG - Intronic
1170302460 20:14899729-14899751 TGCCTTTTAAGAAGCTGCTATGG - Intronic
1171123883 20:22585672-22585694 TTTCTATTAAGCAGTCCCTCTGG - Intergenic
1171503205 20:25610825-25610847 TTTTTTTTAAAAAGCTCTTGGGG + Intergenic
1172135622 20:32684766-32684788 CTTGTTTGCAGAAGCTCCTCAGG - Intergenic
1172491659 20:35343859-35343881 TGTATTTTAACAAGATCCTCAGG + Intronic
1174740822 20:53012460-53012482 TTTCATTTAACAAGATCCGCAGG + Intronic
1175030241 20:55946203-55946225 ATTCCTTTAAGAACCTCTTCTGG - Intergenic
1177045062 21:16158988-16159010 TGTAGTTTAAGAAGCTCTTCAGG + Intergenic
1178333132 21:31718595-31718617 TTTGTTTTAAAAAGCTTTTCGGG - Intronic
1179434719 21:41352343-41352365 TTTCTTCTGAGAAGCCTCTCTGG + Intronic
1181156635 22:20926312-20926334 TTACTTTTGAGAAACTGCTCTGG + Intronic
1181600282 22:23947847-23947869 TTTATTTTCATAAGATCCTCAGG - Intergenic
1181608222 22:23993473-23993495 TTTATTTTCATAAGATCCTCAGG + Intergenic
1182880256 22:33726896-33726918 TTTCTATTAAGATGATCATCAGG - Intronic
1182963003 22:34493981-34494003 TTTCATGCAAGAAGCTCCTCTGG + Intergenic
1183224625 22:36541027-36541049 TATCTTTTAAGAAGCACCATAGG + Intergenic
1184621045 22:45677224-45677246 CTTCATTCAAGAAGCTCATCAGG - Intronic
949833171 3:8238791-8238813 TTTTTTTTAAGTACCTCTTCTGG + Intergenic
949838018 3:8290273-8290295 TTTTTTTTTAGAAACTTCTCAGG - Intergenic
949876792 3:8631524-8631546 CTTCTTTTAAGAAGCTTTTCAGG - Intronic
951356493 3:21673114-21673136 TTAATTTTAAGAAATTCCTCTGG - Intronic
951500241 3:23378113-23378135 TTTATTTTAAGAAACTTCTGTGG - Intronic
951612950 3:24511845-24511867 TTCATTTTAACAAGATCCTCAGG + Intergenic
952301954 3:32111175-32111197 TTTCTTTTAACCAGCACCTTGGG + Intronic
952523338 3:34184402-34184424 ATTTTTCTAAGAAGCTCTTCTGG - Intergenic
953035087 3:39204075-39204097 CTTCTGTTCAGCAGCTCCTCTGG + Intergenic
953201851 3:40784813-40784835 TTTATTGAAAGAAGCTCTTCAGG - Intergenic
957051411 3:75415100-75415122 TTTCTTTAAAGAGACACCTCTGG + Intergenic
957273058 3:78056024-78056046 TTTCCTTTAAGAGTCTCCTGAGG + Intergenic
957391918 3:79585786-79585808 TTACTTTTAAGAAGCATCTCAGG + Intronic
957633935 3:82757628-82757650 TTTCATTTAAAAGGCTTCTCAGG + Intergenic
957861905 3:85963678-85963700 TTTTTTTAAAGTAGCTCATCAGG + Intronic
958904302 3:99925005-99925027 TTTCTTTAATGTAGCTTCTCAGG - Intronic
959874315 3:111363907-111363929 TGTATTTTAAGAGGCTCATCAGG + Intronic
960249413 3:115435812-115435834 TTTCTTTCAAAAAGCTGTTCTGG - Intergenic
960254465 3:115497439-115497461 TGTGTTTTAAGAAGCCCCCCAGG + Intergenic
961303069 3:125934494-125934516 TTTCTTTAAAGAGACACCTCTGG - Intronic
961526065 3:127498422-127498444 TTTTTTTATAAAAGCTCCTCAGG - Intergenic
961577210 3:127847322-127847344 TTTCTTTCAAGCACCCCCTCAGG - Intergenic
961606459 3:128099068-128099090 TCTGTGTTTAGAAGCTCCTCAGG - Intronic
961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG + Exonic
962395243 3:135009620-135009642 CTTCTGTTAGGAAGCTTCTCAGG - Intronic
962575905 3:136754485-136754507 TTTCTTTTAAGACACTTCCCCGG + Intergenic
962678893 3:137778475-137778497 TATCCTTTAAGAAGGTCGTCTGG + Intergenic
964161419 3:153650270-153650292 TTTCTTTTAAGTACTTCCTTTGG + Intergenic
964375502 3:156044894-156044916 TTTCTTTCAAGAGACACCTCTGG - Intronic
965374302 3:167903292-167903314 TTTCTTTTACTCAGCTCCTCAGG + Intergenic
965657050 3:170998580-170998602 TTTCTTATAAGGAAATCCTCTGG + Intronic
966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG + Intergenic
966599519 3:181761364-181761386 GTATTTTTAAAAAGCTCCTCAGG + Intergenic
966801835 3:183771430-183771452 ATTCTTTTAAGAAAATACTCAGG - Intronic
967082287 3:186061315-186061337 TACATTTTTAGAAGCTCCTCAGG + Intronic
967379859 3:188845611-188845633 TTTCTTTCATAAATCTCCTCTGG + Intronic
967443072 3:189531384-189531406 TTTCTTGTTAGAAGCCGCTCTGG + Intergenic
967830151 3:193911716-193911738 TTCATTTTCAGAAGCTCCTCTGG + Intergenic
968395169 4:229197-229219 TTTCTTTTATGTAGCTACTTAGG + Intergenic
968994193 4:3935479-3935501 TTTCTTTCAAGACACACCTCTGG + Intergenic
969456527 4:7303147-7303169 TTCTTTTTAAAAAGGTCCTCTGG - Intronic
969625639 4:8304004-8304026 TTTCTCTTAAGAAGCACATCTGG + Intronic
969762394 4:9198524-9198546 TTTCTTTCAAGAAGCAACACAGG + Intergenic
969819737 4:9710757-9710779 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
970518547 4:16859743-16859765 TTTCTTTTCAGTAACCCCTCTGG - Intronic
971748840 4:30619926-30619948 TGTGGTTTAAGAAGCCCCTCTGG - Intergenic
971756000 4:30709626-30709648 TTTCTGTTAAAAATCTCCACTGG + Intergenic
971879704 4:32355080-32355102 TTTCTCTCAAGAATCTCCTATGG + Intergenic
972053618 4:34772103-34772125 TTTTTTTTAAGATGATTCTCGGG + Intergenic
972804342 4:42512732-42512754 TCTGTGTTAATAAGCTCCTCGGG - Intronic
973683882 4:53349807-53349829 TTTCTTTTAGCAAACTCCTCTGG + Intronic
973860101 4:55055317-55055339 TTTCTTTTAAATATCTCCTGTGG - Intergenic
974300177 4:60054238-60054260 TTTCTTTAAAGAAACTCTTAGGG + Intergenic
974393458 4:61304709-61304731 TCTGTTTTAACAAGCTCCTAAGG + Intronic
974803037 4:66843696-66843718 TTTCTTTTCAAAAGTTCCTGTGG - Intergenic
974830968 4:67189273-67189295 TTTGTTTTAAATAGCTCCACTGG - Intergenic
975589848 4:75989001-75989023 TTTTTTTTAAGAATTTACTCTGG - Intronic
977615035 4:99078777-99078799 TTTTGTTCAAGAAACTCCTCTGG - Intronic
977838797 4:101676328-101676350 TTTCTGAAAAGAAACTCCTCTGG - Intronic
978629543 4:110728094-110728116 TTTCCTTTTATAAGCTCATCAGG - Intergenic
979160732 4:117457531-117457553 TTACTTTCAAGAAGGTCATCTGG - Intergenic
979221684 4:118233937-118233959 CTTCTCATAAGCAGCTCCTCAGG - Intronic
980989158 4:139723920-139723942 TATGTTTTAACAAGCTCCGCTGG + Intronic
982903916 4:161043923-161043945 GTACTCTTAAGAAGCTCCTAGGG - Intergenic
984160766 4:176249754-176249776 TTTCTTTTAAGGATCGCCTAAGG - Intronic
984625478 4:182002653-182002675 TTGATTTTAAGAAGTTCATCAGG - Intergenic
985535324 5:461828-461850 TTTATTTTTAGAGGCTCATCCGG + Intronic
986018090 5:3775325-3775347 GTTCTTAAAAGATGCTCCTCTGG + Intergenic
986189496 5:5481525-5481547 TGTTTTTTAAGAAGCTTCTCTGG - Intronic
986599334 5:9456018-9456040 TTCTTTTTAAGCACCTCCTCTGG - Intronic
986629530 5:9756424-9756446 TTTCTTATAAGAAGATTCTGGGG - Intergenic
986685524 5:10272630-10272652 CTTCCTTTGTGAAGCTCCTCTGG + Intergenic
987146053 5:14992897-14992919 TGCATTTTAAGAAGCTCCCCAGG + Intergenic
987817951 5:22928560-22928582 TTTTTTTTCTGAAGCTGCTCAGG - Intergenic
987878169 5:23708158-23708180 TTGCTTTTAAGAAATTGCTCTGG - Intergenic
987995794 5:25276797-25276819 ATTCTTTTATGAAACTACTCAGG - Intergenic
988446103 5:31287717-31287739 TGTGTTTTAAGAAACTCCTTAGG - Intronic
988616731 5:32782120-32782142 TTTCTCTTAATTGGCTCCTCTGG - Intronic
990357644 5:54986003-54986025 TTTTTTTGAAGAAGCTTCTTCGG - Intronic
990889261 5:60631360-60631382 TTTCTGCTGAGAAGATCCTCAGG - Intronic
992742760 5:79790602-79790624 TGTATTTTAACAAGATCCTCAGG - Intronic
993134250 5:83937337-83937359 TTTGTTTTAAAAAGCCTCTCAGG + Intergenic
993330658 5:86596122-86596144 TTTCTTTAAATCAGCTCCTTAGG - Intergenic
996589890 5:125134866-125134888 TTTATTTTCTGTAGCTCCTCTGG - Intergenic
996692346 5:126353912-126353934 TTTTTTTTAACAAGCTTCCCAGG - Intergenic
998346150 5:141465785-141465807 TTTTTTTTAAGAAACCCTTCAGG + Intronic
998797395 5:145834920-145834942 TTCCTTTTAGGAAGAGCCTCCGG - Intronic
999654302 5:153797430-153797452 TTTCTTTTAAAACTCTCTTCTGG + Intronic
1001118300 5:168957718-168957740 GTGTTTTTAACAAGCTCCTCCGG + Intronic
1001210489 5:169806431-169806453 TGACTTTTAAAAAGCTCCCCGGG - Intronic
1001280671 5:170384104-170384126 AATCTTTTTAGAAGCTCCCCAGG - Intronic
1001373060 5:171226111-171226133 TTTCTTTTATTAAGTTGCTCAGG - Intronic
1001451755 5:171831162-171831184 TTTCTTTTAAAAACCTTCCCTGG - Intergenic
1002038856 5:176495816-176495838 TTTCTATTAATAAGCTTCTTTGG + Intronic
1002146838 5:177190589-177190611 TTTCTTTTAAAAAGCTCTAAGGG - Intronic
1003211865 6:4075973-4075995 TTATTTTTAAAAAGCTCCCCAGG - Intronic
1006415694 6:33902621-33902643 ATTCTTCTAATAAGCTCCTGTGG + Intergenic
1006673080 6:35742187-35742209 TTGCTTTTAACAAGCTCTCCAGG - Intronic
1006815275 6:36845675-36845697 TTGCTTTTAAGTGGATCCTCTGG - Intergenic
1007179982 6:39922967-39922989 TTGCTCTGAAGCAGCTCCTCTGG + Intronic
1007274916 6:40666213-40666235 ATTATTATAACAAGCTCCTCTGG - Intergenic
1008258398 6:49333461-49333483 TGTGTTTTAACAAGCCCCTCAGG - Intergenic
1009424752 6:63501735-63501757 GATCTTTTAAGAAGATCCTAGGG + Intergenic
1009488474 6:64256479-64256501 TTTCATTTAAGCAGCTCCTGTGG + Intronic
1011042395 6:83044647-83044669 TTTCCACTAGGAAGCTCCTCAGG - Exonic
1012033459 6:94102030-94102052 TGTGTTTTAAGAAGCCCTTCTGG + Intergenic
1013168223 6:107613074-107613096 TGTCTTTTAACAAGCTCTCCAGG + Intronic
1013208670 6:107967482-107967504 TTTCATTTAAGAAACTCCTCTGG + Intergenic
1013445121 6:110217485-110217507 TCCCCTTGAAGAAGCTCCTCAGG - Intronic
1013566749 6:111371993-111372015 TTTCTTTTAAGAATTTTTTCAGG - Intronic
1013986990 6:116206241-116206263 TTTACTTTAACAAGTTCCTCTGG - Intronic
1014762494 6:125372084-125372106 TATTTTTTAAAAAACTCCTCAGG - Intergenic
1015584275 6:134759378-134759400 TTCCTTTTAACAAAATCCTCAGG + Intergenic
1016011376 6:139140733-139140755 TTTCTGTAAAGAATCTCTTCTGG - Intronic
1016269741 6:142274716-142274738 TCTCCTTTAAGAAGCTTCTGAGG + Intergenic
1016468975 6:144354901-144354923 TATCTTTTAATAATCTCTTCAGG + Intronic
1016683457 6:146856181-146856203 TTTCTTTTTTGAAGATTCTCAGG - Intergenic
1017619534 6:156281463-156281485 TTTTTTTTAAGAAACCACTCAGG + Intergenic
1017822967 6:158061981-158062003 CCTCTTTTCAGAAGCTGCTCTGG + Exonic
1017897179 6:158690852-158690874 TTGCCTTTAGGAAGCTCCCCAGG + Intronic
1018921019 6:168174401-168174423 TTTCTCTCCAGAAGCTTCTCAGG + Intergenic
1019267099 7:123914-123936 TTGCTTCTAAAATGCTCCTCAGG - Intergenic
1019978152 7:4601050-4601072 TTTTTTTTAAGAAACAACTCAGG + Intergenic
1020874736 7:13678302-13678324 TTTTTTTTAAGAAGCTGATGAGG - Intergenic
1021473176 7:21029593-21029615 TTTCCTTTAAGAAGATGCTTAGG - Intergenic
1021511316 7:21435854-21435876 TTTTTTTTAAGAAGGACTTCAGG + Intronic
1022075408 7:26964312-26964334 TTCATTTTAGGAAGTTCCTCAGG - Intronic
1022829514 7:34051413-34051435 CATTCTTTAAGAAGCTCCTCAGG + Intronic
1023164902 7:37334065-37334087 TTGTTTTTATGAAGCTCCCCTGG - Intronic
1023407190 7:39847076-39847098 TCTGTTTTAAGAAGTTCCTGTGG + Intergenic
1023751176 7:43374073-43374095 TTTCTTTGAGGAAACTCCACTGG + Intronic
1025072782 7:55915442-55915464 TGTCTTTCAATAAGCTCCTTGGG - Intronic
1027431958 7:78123792-78123814 TATGTTTTAGGAAGCTCTTCAGG - Intronic
1028074233 7:86491945-86491967 TTTCTTTTTTAGAGCTCCTCAGG - Intergenic
1029024797 7:97404801-97404823 TGTCATTTAACAAGCTCTTCAGG + Intergenic
1029024984 7:97406981-97407003 TTTTTTTTGACAAGCTCTTCTGG - Intergenic
1030076228 7:105739340-105739362 TATATTTTAACAAGATCCTCAGG + Intronic
1030375375 7:108747282-108747304 TTTCTCTTAATAAACTCCTTAGG + Intergenic
1031855848 7:126921805-126921827 CTTTTTTTAGGAAGCTTCTCAGG + Intronic
1031869305 7:127074898-127074920 TGGATTTTAAGATGCTCCTCAGG + Intronic
1031942545 7:127804436-127804458 TTGCTTTTAAGACACTCCACAGG - Intronic
1032508469 7:132453437-132453459 TGTGTTTTAACAAGCTCCCCAGG + Intronic
1032967744 7:137120510-137120532 TGTCTTTTCAGAAGCTTTTCAGG - Intergenic
1034044401 7:147912692-147912714 TTTCATTAATGAGGCTCCTCAGG + Intronic
1034062624 7:148107046-148107068 ATTTTTTTATGAAGCTCTTCAGG - Intronic
1034296465 7:149977179-149977201 TCCCTTTTTAGAAGCTCCTGGGG + Intergenic
1034636599 7:152572099-152572121 ATTCTTTTAAGCAGCTGCTAAGG + Intergenic
1034809565 7:154119638-154119660 TCCCTTTTTAGAAGCTCCTGGGG - Intronic
1034845737 7:154442913-154442935 TTTCCTCTAAGCAGCTCCCCTGG + Intronic
1035078864 7:156199637-156199659 ATACTTTTAACAAGCTCTTCAGG + Intergenic
1035531405 8:354572-354594 TCTAGTTTAATAAGCTCCTCAGG + Intergenic
1036272478 8:7320260-7320282 TTTCTTTCAAGAAGCAACACAGG + Intergenic
1036348870 8:7990084-7990106 TTTCTTTCAAGAAGCAACACAGG - Intergenic
1036381945 8:8241348-8241370 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
1036844133 8:12150557-12150579 TTTCTTTCAAGAAGCAACACAGG - Intergenic
1036865507 8:12392878-12392900 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1037424337 8:18738969-18738991 TTCCTTTTAAGAAGAACCTTCGG + Intronic
1038237528 8:25774598-25774620 GTTCTTTAAAGAATCTCCACTGG - Intergenic
1039059206 8:33560148-33560170 TACGTTTTAACAAGCTCCTCAGG + Intronic
1039508967 8:38073564-38073586 TTTCCGTTAACATGCTCCTCTGG - Intergenic
1039918784 8:41878466-41878488 TTTATAAAAAGAAGCTCCTCTGG + Intronic
1039973598 8:42340929-42340951 TTAGTTTGAAGAAGCTCATCGGG + Intronic
1040014322 8:42688957-42688979 TTTGTTTTTTTAAGCTCCTCAGG - Intergenic
1040085973 8:43342064-43342086 GTTGTTTTAAGAAGCACCTGTGG + Intergenic
1041109534 8:54471533-54471555 TTTCCTTTAAGCAGCTCCATGGG + Intergenic
1041537767 8:58946375-58946397 TTTCTTTTGAGAAGACCTTCAGG + Intronic
1041996522 8:64066957-64066979 GTACTTTTAAGAAGCACCTGTGG - Intergenic
1042304904 8:67321385-67321407 GTATTTTTAAGAAGCTCCACGGG + Intronic
1043605988 8:82000401-82000423 TTTTTTTTAATTATCTCCTCTGG - Intergenic
1044720136 8:95137398-95137420 TTCTTTTTAAGTAGCTCTTCAGG - Intronic
1045113998 8:98962785-98962807 TTTCTTTTAAATAGCTAGTCAGG - Intergenic
1045339885 8:101244141-101244163 TTAATTTTAACAAGATCCTCAGG - Intergenic
1046349669 8:112990885-112990907 TTTCTTTTAAGAAACACATTTGG - Intronic
1046672927 8:117077220-117077242 GTATTTTTAACAAGCTCCTCCGG - Intronic
1047201483 8:122771286-122771308 TTCCTTTTAGGAAGCTCCAGAGG + Intergenic
1047333516 8:123914641-123914663 CCTCTTTTTAGCAGCTCCTCTGG - Intronic
1048201680 8:132379852-132379874 TTACTTTCTAGAAGCTCCTGAGG + Intronic
1048708744 8:137184240-137184262 TTTCCTGTAATAATCTCCTCTGG - Intergenic
1050598865 9:7230847-7230869 TTTCTTTCAAGATTCTACTCTGG + Intergenic
1051161297 9:14211317-14211339 TTTCTTTTAAGAAACTTCCCAGG - Intronic
1051405014 9:16727593-16727615 TTTCTTTTAAGACGCCCTTAGGG + Intronic
1051524098 9:18023220-18023242 TGTGTTTTAAGAAGCCCTTCAGG - Intergenic
1052186901 9:25608980-25609002 TTTATATTAGAAAGCTCCTCTGG + Intergenic
1054711334 9:68514125-68514147 TGTATTTTAACAAGCTCCTCAGG + Intronic
1055981864 9:82011646-82011668 TTTTTCTTTAAAAGCTCCTCAGG - Intergenic
1056017444 9:82405289-82405311 TGTCCTTTAAGAAGATCCCCAGG + Intergenic
1056186219 9:84137646-84137668 TTACATTTAATAAGCTCCCCAGG + Intergenic
1056888057 9:90463230-90463252 TTTATTTTAAAAAGCTGCCCAGG + Intergenic
1057504258 9:95619742-95619764 TTTCCCTTAAGAAGCTCCCATGG + Intergenic
1058166653 9:101626608-101626630 TTCATTTTAACAAGCTCCCCAGG - Intronic
1058941700 9:109819131-109819153 TTTCTTATAAGATGCTCTGCAGG - Intronic
1059275986 9:113097593-113097615 TTTCTTCTAAGAAGCTTCATGGG - Intergenic
1059519209 9:114924173-114924195 TGCATTTTAACAAGCTCCTCAGG - Intronic
1059622926 9:116028437-116028459 TTTCTTTTCAGAAACAACTCAGG - Intergenic
1061487534 9:130927967-130927989 TGCCTTTTAACAAGCACCTCTGG + Intronic
1186110765 X:6253415-6253437 TATCTTAGAAGAAGCTCCTATGG - Intergenic
1186225098 X:7390155-7390177 TTTATATTAAAAATCTCCTCTGG - Intergenic
1187101846 X:16200989-16201011 TTTCTTTTTAAAATCTCCTGAGG - Intergenic
1187232343 X:17434969-17434991 CTTCTTTCTAGAAGCTTCTCTGG - Intronic
1187292379 X:17967460-17967482 TATATTCTAAGAAGATCCTCAGG - Intergenic
1188230240 X:27653472-27653494 TTTGTTTTAGGAAGCTACTTGGG - Intronic
1190473795 X:50808710-50808732 TTTCTTTAAAGAAATTCCTGGGG + Intronic
1190624803 X:52326676-52326698 CTTCTCTTGAGCAGCTCCTCTGG - Intergenic
1191063123 X:56319652-56319674 ATTCTTTTAAGAAACTCTGCGGG + Intergenic
1192925269 X:75749039-75749061 TTTCATTTAAGAAACTTCTATGG - Intergenic
1193811894 X:86061521-86061543 TTTGTTTTAACAAGTTCTTCAGG - Intergenic
1193963405 X:87952647-87952669 TTTCTTTTAAGCACCTCTTATGG + Intergenic
1194291252 X:92074111-92074133 TTACTTTTAACATGCTCCCCAGG - Intronic
1194396039 X:93387584-93387606 TGTGTTTTAACAAGCTCTTCAGG - Intergenic
1195667415 X:107443659-107443681 TTTTTTTTAACAAGCCCCTTGGG - Intergenic
1196184045 X:112726264-112726286 CCTCTTTTCAGTAGCTCCTCTGG - Intergenic
1196711932 X:118771464-118771486 TGTGTTTTAACAAACTCCTCTGG + Intronic
1197156558 X:123276239-123276261 TTTCTTTTTTGAAGCTCATTTGG + Intronic
1197276033 X:124480309-124480331 TGTCTTTTATAAAGCCCCTCTGG - Intronic
1197454214 X:126657611-126657633 TTTCCTTTAATGAGCTCTTCTGG - Intergenic
1197638385 X:128941763-128941785 TGTATTTTAACAAGATCCTCAGG + Intergenic
1198138383 X:133777786-133777808 TTTATTTTAACAAGCTCCCCAGG + Intronic
1198810802 X:140534337-140534359 TATATTTTAACAAGATCCTCAGG - Intergenic
1199440279 X:147860037-147860059 TGTCTTTAAATAAGCTCCCCAGG + Intergenic
1200608766 Y:5298694-5298716 TTACTTTTAACATGCTCCCCAGG - Intronic
1200617588 Y:5398891-5398913 TTTCTTTTTAGAAGCTTTTAAGG + Intronic
1200868934 Y:8076258-8076280 GTTATTTTAACAAGGTCCTCAGG - Intergenic
1201485359 Y:14488330-14488352 TATCTTGGAAGAAGCCCCTCTGG + Intergenic