ID: 1112362020

View in Genome Browser
Species Human (GRCh38)
Location 13:98727046-98727068
Sequence TTTCTTTTAAGAAGCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 435}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112362009_1112362020 28 Left 1112362009 13:98726995-98727017 CCCGGCCCCAGACTCATGCTTCT 0: 1
1: 0
2: 1
3: 40
4: 379
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362012_1112362020 22 Left 1112362012 13:98727001-98727023 CCCAGACTCATGCTTCTTATCTG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362010_1112362020 27 Left 1112362010 13:98726996-98727018 CCGGCCCCAGACTCATGCTTCTT 0: 1
1: 0
2: 5
3: 30
4: 398
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362019_1112362020 -9 Left 1112362019 13:98727032-98727054 CCTGGCATCTGTATTTTCTTTTA 0: 1
1: 0
2: 11
3: 125
4: 1119
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362013_1112362020 21 Left 1112362013 13:98727002-98727024 CCAGACTCATGCTTCTTATCTGA 0: 1
1: 1
2: 0
3: 18
4: 184
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435
1112362011_1112362020 23 Left 1112362011 13:98727000-98727022 CCCCAGACTCATGCTTCTTATCT 0: 1
1: 0
2: 0
3: 21
4: 303
Right 1112362020 13:98727046-98727068 TTTCTTTTAAGAAGCTCCTCAGG 0: 1
1: 0
2: 3
3: 36
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112362020 Original CRISPR TTTCTTTTAAGAAGCTCCTC AGG Intronic