ID: 1112367496

View in Genome Browser
Species Human (GRCh38)
Location 13:98767831-98767853
Sequence GCTTCCAGAGTGACCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112367496_1112367497 -5 Left 1112367496 13:98767831-98767853 CCTGCTCTGGTCACTCTGGAAGC No data
Right 1112367497 13:98767849-98767871 GAAGCTGACCAGTCTACACATGG 0: 5
1: 11
2: 26
3: 58
4: 191
1112367496_1112367499 8 Left 1112367496 13:98767831-98767853 CCTGCTCTGGTCACTCTGGAAGC No data
Right 1112367499 13:98767862-98767884 CTACACATGGCTGCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112367496 Original CRISPR GCTTCCAGAGTGACCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr