ID: 1112368430

View in Genome Browser
Species Human (GRCh38)
Location 13:98774553-98774575
Sequence CCTCAGCCTCCTGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112368430_1112368435 9 Left 1112368430 13:98774553-98774575 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG No data
1112368430_1112368434 3 Left 1112368430 13:98774553-98774575 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1112368434 13:98774579-98774601 GAGACTCGCTTGAGCCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112368430 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG (reversed) Intergenic