ID: 1112368435

View in Genome Browser
Species Human (GRCh38)
Location 13:98774585-98774607
Sequence CGCTTGAGCCCGAGAGGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112368430_1112368435 9 Left 1112368430 13:98774553-98774575 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG No data
1112368432_1112368435 8 Left 1112368432 13:98774554-98774576 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1112368435 13:98774585-98774607 CGCTTGAGCCCGAGAGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112368435 Original CRISPR CGCTTGAGCCCGAGAGGCGA AGG Intergenic
No off target data available for this crispr