ID: 1112371179

View in Genome Browser
Species Human (GRCh38)
Location 13:98795125-98795147
Sequence TATGATCTGGTGAGCGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112371179_1112371183 1 Left 1112371179 13:98795125-98795147 CCTTCTACGCTCACCAGATCATA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1112371183 13:98795149-98795171 GGCAACGTGAGGTCTACTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1112371179_1112371182 -10 Left 1112371179 13:98795125-98795147 CCTTCTACGCTCACCAGATCATA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1112371182 13:98795138-98795160 CCAGATCATAAGGCAACGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 64
1112371179_1112371184 11 Left 1112371179 13:98795125-98795147 CCTTCTACGCTCACCAGATCATA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1112371184 13:98795159-98795181 GGTCTACTTAAGGCAACGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112371179 Original CRISPR TATGATCTGGTGAGCGTAGA AGG (reversed) Intronic
904568464 1:31442831-31442853 TCTTAGCTTGTGAGCGTAGAAGG + Intergenic
912245480 1:107957691-107957713 TATGGTGTGGTGAGAGTAAAGGG + Intronic
915482568 1:156197146-156197168 TATGATCTTGCGACCCTAGATGG + Intronic
1064105958 10:12501355-12501377 TATCATCTGGTGAGGGGCGAGGG + Intronic
1064493918 10:15887691-15887713 TATGAAGTGGTGAAAGTAGATGG - Intergenic
1067575413 10:47405411-47405433 TCTGATCTGGTAAGCATAGTGGG - Intergenic
1075346442 10:121685564-121685586 TGGGATCTGGTGGGCATAGATGG + Intergenic
1076739327 10:132474583-132474605 TATTATCTGTTGACCGTAGATGG - Intergenic
1080875802 11:36273326-36273348 GATGATCTGGTGAGTGAAGGGGG + Intergenic
1085175649 11:74485992-74486014 CATGATGTGGTCAGGGTAGATGG + Intergenic
1095772152 12:45971756-45971778 AATGATCTGGTGATGGTAGTGGG + Intronic
1097159678 12:57037507-57037529 TAGCATTTGGTGAGGGTAGAAGG - Intronic
1098278867 12:68841950-68841972 CATGATGTGGTCAGGGTAGATGG - Exonic
1100648908 12:96562844-96562866 TATGACCTGCTGGGTGTAGAGGG + Intronic
1100745385 12:97640135-97640157 TAGGATCAAGTGAGCCTAGAAGG + Intergenic
1101247742 12:102900823-102900845 AAAGATGTGGTGAGCGTATATGG - Intronic
1103098309 12:118149745-118149767 TGTGAACTGGTGAACCTAGAAGG + Intergenic
1104780967 12:131420309-131420331 AGTGAACTGGTGAGCGCAGAGGG - Intergenic
1108783847 13:53870519-53870541 AATGATCAGGTTAGTGTAGATGG + Intergenic
1112371179 13:98795125-98795147 TATGATCTGGTGAGCGTAGAAGG - Intronic
1113504513 13:110806006-110806028 TATGATCTTGTGGGCAGAGAGGG + Intergenic
1122781480 14:104145679-104145701 TATGAGCTGGGGAGGGAAGATGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1143763553 17:9121959-9121981 TATGATCTGGTCAGTGCAGAGGG + Intronic
1143902297 17:10183422-10183444 TATGCTCTGGTGATCATAGTTGG - Intronic
1158647970 18:59264528-59264550 TAGAATCTGGTGACGGTAGAGGG - Intergenic
1163094554 19:15047180-15047202 TAGGATCTGGTCAGCTAAGAAGG + Intergenic
934546767 2:95224324-95224346 TATGATCTGGTGTGGTTTGAAGG + Intronic
939948374 2:148438450-148438472 TATGATCAGGTAAGTGTACAAGG - Intronic
940792816 2:158045976-158045998 TATGATCTTGTGGGCTTTGAGGG - Intronic
942638980 2:178040368-178040390 TTTAATCTGGTGTGAGTAGAAGG + Intronic
1168861079 20:1046430-1046452 TATGATCTGGTGGGCACTGAGGG + Intergenic
1172962425 20:38807893-38807915 GATGATCTGGAGAGCACAGATGG - Intronic
1173229857 20:41185566-41185588 TATGTTCTGGAGAGCCTGGAAGG - Intronic
953552550 3:43914911-43914933 AATGAACTGGTGAGCCTAGATGG - Intergenic
962070577 3:132029517-132029539 TAGGAGCTGGTGAGTCTAGAAGG - Intronic
962650548 3:137484578-137484600 TTTGATCTTGTGAAGGTAGAGGG - Intergenic
964104488 3:153024278-153024300 TTTGATCTGTTGAGGGCAGATGG - Intergenic
968357396 3:198120001-198120023 TATGAGCTGGTGGGCTGAGAGGG - Intergenic
970786306 4:19800848-19800870 TGTGATATGGTGAGAGTAGTAGG - Intergenic
971756779 4:30717788-30717810 TATGGTCTGGAGAGGGAAGAGGG + Intergenic
990690073 5:58354056-58354078 TATGCTTTGGTGAGGGGAGAAGG - Intergenic
991467987 5:66935306-66935328 TATGATGTTTTTAGCGTAGAAGG + Intronic
1000249847 5:159483448-159483470 TATGATGTGGTGAGCTCTGATGG + Intergenic
1011656776 6:89559319-89559341 TAGGATCTGGTTAGGTTAGAAGG - Intronic
1028491177 7:91413948-91413970 AATGATCTGGTAAGAGTAGAGGG + Intergenic
1029220378 7:98983875-98983897 TATGATTTGGTTAGCCAAGATGG + Intronic
1030630394 7:111889037-111889059 TATGAACTGGTTAGCATTGAAGG + Intronic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1032774944 7:135102667-135102689 TATGATCTGGAGATGGGAGATGG - Intronic
1038375124 8:27032573-27032595 TGTGATCTGGTGAGCACTGAGGG + Intergenic
1044222978 8:89690942-89690964 TATGAAGTGGGGAGCTTAGAAGG - Intergenic
1044517320 8:93154628-93154650 TTTGACCTGGTGAGCTCAGAAGG + Intronic
1198089142 X:133310580-133310602 TCTGCTCTGGTGAGAGTGGAAGG - Intronic
1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG + Intergenic