ID: 1112372217

View in Genome Browser
Species Human (GRCh38)
Location 13:98803987-98804009
Sequence CTTTAAAAAGAGAGACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112372217_1112372219 -8 Left 1112372217 13:98803987-98804009 CCATCCAGTCTCTCTTTTTAAAG 0: 1
1: 0
2: 0
3: 44
4: 429
Right 1112372219 13:98804002-98804024 TTTTAAAGCATACGCTTCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 112
1112372217_1112372222 14 Left 1112372217 13:98803987-98804009 CCATCCAGTCTCTCTTTTTAAAG 0: 1
1: 0
2: 0
3: 44
4: 429
Right 1112372222 13:98804024-98804046 GTGAGAGCTGATAAGCACCTGGG 0: 1
1: 0
2: 3
3: 11
4: 126
1112372217_1112372221 13 Left 1112372217 13:98803987-98804009 CCATCCAGTCTCTCTTTTTAAAG 0: 1
1: 0
2: 0
3: 44
4: 429
Right 1112372221 13:98804023-98804045 GGTGAGAGCTGATAAGCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112372217 Original CRISPR CTTTAAAAAGAGAGACTGGA TGG (reversed) Intronic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
902305785 1:15538099-15538121 GTTTAAAAAGAGAGACTGCTGGG + Intronic
903089557 1:20899606-20899628 CTTTTTAGAGAGATACTGGATGG - Intronic
903089621 1:20900308-20900330 ATATAAAAAGAAACACTGGAGGG + Intronic
905181503 1:36169976-36169998 ATTTAAAAAAAGAGACTTAAAGG + Intronic
905521002 1:38599716-38599738 CTTTAACACCAGAGACTGGTAGG + Intergenic
906502530 1:46351962-46351984 TTTTTTAAAAAGAGACTGGAAGG - Intronic
906805845 1:48777896-48777918 CTTGCCAAAGAGAGCCTGGAGGG + Intronic
906857773 1:49327088-49327110 CTTGTAAGAGGGAGACTGGAAGG - Intronic
907718979 1:56953956-56953978 CTTTAAAAATTGAGATTTGATGG + Intronic
908737818 1:67294321-67294343 CTTTAAACTGTGAGACTAGATGG + Intergenic
909543288 1:76815075-76815097 TATCAAAAAAAGAGACTGGAGGG + Intergenic
909962888 1:81869346-81869368 GCTTAAAAAAAGAGACTGGAAGG + Intronic
910789134 1:91032967-91032989 TTTTAAAGAGAGAGCATGGAAGG + Intergenic
912727376 1:112070060-112070082 CTCTGAAAAGAGTAACTGGAGGG - Intergenic
913471434 1:119191318-119191340 TTTTAAAAAGTGAAACTAGATGG + Intergenic
913613526 1:120531961-120531983 CTTAAAAAAGAGAGAATGAAGGG - Intergenic
914371971 1:147033516-147033538 CTTAAAAAAGAGAGAATGAAGGG - Intergenic
914577546 1:148989290-148989312 CTTAAAAAAGAGAGAATGAAGGG + Intronic
914577656 1:148990288-148990310 CTTAAAAAAGAGAGAATGAAGGG + Intronic
915860664 1:159440872-159440894 CTTTAAATAAAGTTACTGGATGG + Intergenic
916185578 1:162129338-162129360 GTTTAAAAAATGAGGCTGGATGG - Intronic
917318475 1:173754160-173754182 TTTTAACAGGAGAGGCTGGAGGG + Intronic
917403657 1:174680319-174680341 CTTTAATAAAAGAGGCCGGAAGG + Intronic
917554358 1:176068258-176068280 CTTTAAAAAGAAAGGAGGGAGGG - Intronic
918260195 1:182789229-182789251 CTTTAACACGAGAGTCTGCAGGG + Intergenic
918473503 1:184899385-184899407 ATAGAAACAGAGAGACTGGAGGG - Intronic
918510724 1:185310997-185311019 CTTTAAAAAAAGAGTATGAAAGG + Intronic
918759509 1:188384621-188384643 CTTTAAAAACAGTGACAAGATGG - Intergenic
920743954 1:208607832-208607854 GTTTAAAGAGAGAGAATGTAGGG + Intergenic
921478498 1:215636997-215637019 CTTCAAAAAGACAGAAGGGAAGG - Intronic
921940148 1:220830702-220830724 GTGTAAAATGAGAGATTGGATGG + Intergenic
923407807 1:233680251-233680273 TTTTACACAGAAAGACTGGAGGG + Intergenic
923557283 1:235011033-235011055 CTTTAAAAAGATATAGTTGAGGG - Intergenic
923792490 1:237123924-237123946 CTTTAAAAATAGTGACTGTTGGG - Intronic
924238219 1:242016858-242016880 CTTTAAAGAGAGAGATTTAAAGG - Intergenic
924367690 1:243313217-243313239 TTTTAAAAAGAAAGTCTAGAAGG - Intronic
1062868468 10:877447-877469 ATTTAAAAAGAGAAACCAGAAGG - Intronic
1063037403 10:2300090-2300112 ATTTCAAAATAGAGACTGGCAGG - Intergenic
1063078252 10:2738510-2738532 TTTTAAAAATAGAAAGTGGAAGG + Intergenic
1063624124 10:7673559-7673581 CTTCAATAAGAGAGACCTGAGGG - Intergenic
1064378880 10:14822412-14822434 CTTTCAAAAGAAAGTCTAGAGGG + Intronic
1065560201 10:26956455-26956477 TTTTAAAAATAGAGACTTAATGG - Intergenic
1065771060 10:29079034-29079056 CTTTTAAAAGAGAGAGGAGAGGG - Intergenic
1066396558 10:35029810-35029832 CTTTAAAAAGAAAGTTTGAAAGG - Intronic
1066534561 10:36376691-36376713 CTTTGAAAAGATAGACTAAATGG - Intergenic
1067809533 10:49416651-49416673 CTATAAGAAAAAAGACTGGAAGG + Intergenic
1068912229 10:62390428-62390450 ATTTTAAAAGAGAGAATGAATGG - Intronic
1069024927 10:63529190-63529212 ATTTGGAAAGAGAGACTGAAAGG + Intronic
1069571142 10:69495124-69495146 CTGTAAAACAAGAGGCTGGATGG + Intronic
1070077918 10:73155903-73155925 CTTTAAAAATAGAAACTTCATGG - Intronic
1070237661 10:74646483-74646505 CTTTAACTACAGAGACTGAAGGG - Intronic
1071824564 10:89312058-89312080 CTCTAGAAAGAGAAACTTGAAGG - Intronic
1073958823 10:108902705-108902727 CTTCAGAAAGAGAGACTTGGAGG + Intergenic
1075325103 10:121525245-121525267 CCTTCAAAAGAGTGATTGGAAGG + Intronic
1076359027 10:129873909-129873931 CTTTAAAATGAGTGGCTAGAGGG - Intronic
1076550628 10:131275741-131275763 CTTTAAAAAGGAAGAATGGATGG + Intronic
1079001385 11:16759906-16759928 CTATAAAAATAGAAAATGGACGG + Intergenic
1079066634 11:17299960-17299982 CTTTAAAAAGATAGATTTTATGG - Intronic
1079774927 11:24513087-24513109 ATTAAAAAACAGAGACTGAAAGG - Intronic
1081534326 11:43986309-43986331 CTTTAAAAAGAGTGGGTGGGGGG - Intergenic
1083574202 11:63777645-63777667 CTCTATAAAGAAAAACTGGATGG + Intergenic
1083763417 11:64830903-64830925 CTTTAGAAAGAGAGAAACGAAGG - Intronic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085591712 11:77768455-77768477 CTTTAAAAATAGTGATTGGCCGG - Intronic
1087588838 11:100158008-100158030 ATTTAAAAAGAGAGAAGGAAAGG + Intronic
1087706686 11:101501264-101501286 TTTTAAAAAAAAAGACTGAAAGG + Intronic
1087984854 11:104665084-104665106 CATTAAAAAGAGAAACAGCATGG - Intergenic
1089403841 11:118181289-118181311 CTTTGAAAAGTGAGGCTGTAAGG - Intergenic
1090001479 11:122963860-122963882 CTTTAATAAGAGAGAATACATGG - Intergenic
1090447238 11:126774864-126774886 CTTTAAAAATAGAAGCTTGAGGG - Intronic
1090531346 11:127594163-127594185 ATTTAAAAAGAAAGAATGCAAGG - Intergenic
1090710624 11:129381775-129381797 ATTTATAAAGAGAGATTGAAAGG + Intronic
1091398730 12:170308-170330 CTTCCAAAAGAGAGGCAGGAAGG - Intronic
1092329868 12:7575136-7575158 CCCTAAAACTAGAGACTGGAGGG + Intergenic
1092596916 12:10016953-10016975 CTTTAAAGAGTGAAACAGGAGGG - Intronic
1093407945 12:18828661-18828683 ATTTGAACAGAGAGACTTGAAGG - Intergenic
1095865643 12:46969173-46969195 CTTAAAAAAGGGAGGCAGGAGGG - Intergenic
1095884127 12:47170732-47170754 ATTGAAAAACAGAGACTGGCAGG - Intronic
1095921365 12:47534553-47534575 TTTTAAAAAGTGATACTGAAAGG - Intergenic
1097152734 12:56991539-56991561 CTGGAAAGAGAGAGACTGGGAGG - Intergenic
1097777120 12:63660441-63660463 CTCTGAAAACAGAGATTGGATGG + Intronic
1098062173 12:66574417-66574439 GTTTTAAAAGAGAGAGTGAAAGG - Intronic
1098330705 12:69349378-69349400 CTATACAAAGAGTGACTGAAGGG - Intronic
1098356190 12:69615174-69615196 ATTTAAAAAGAGAGACAGGCTGG + Intergenic
1098477163 12:70919166-70919188 CTTTTAAAAAAGATACTGCAAGG + Intronic
1098971326 12:76860023-76860045 CTTTAAAAGGCCAGACTGTAAGG - Intronic
1099441819 12:82708040-82708062 GTTTAAAAAAACAGACTGCAGGG - Intronic
1099610349 12:84859912-84859934 CTTTAAAGATGGAGAATGGATGG + Exonic
1099851629 12:88105346-88105368 CTTAAAAAAGAGAAAGCGGAGGG + Intronic
1101240657 12:102834912-102834934 TTTTGAAAAGAGAGACATGAGGG + Intergenic
1101241339 12:102842704-102842726 TTTTGAAAAGAGAGACATGAGGG - Intronic
1102819175 12:115893550-115893572 CTTTAAAAAAAAAAACTGGGGGG - Intergenic
1103428284 12:120858053-120858075 TTTTAAAAAGAGAGAAAGGGAGG + Intronic
1103629451 12:122247856-122247878 ATTTAAAAAGAAAGAAAGGAAGG - Intronic
1104067443 12:125317374-125317396 CTTTAACAACAGAGACTGATGGG - Intronic
1105388259 13:19952539-19952561 ATTTAAAAAGAGAAACATGATGG + Intergenic
1106255875 13:28021612-28021634 TTTTGAATAGACAGACTGGAGGG + Intronic
1106452066 13:29891288-29891310 ATTTAAAAAGAAACACTGAATGG + Intergenic
1106634677 13:31515290-31515312 GTTTAAAAAAAGAGAATGGTTGG - Intergenic
1107215191 13:37908899-37908921 CTTTAAAAAGGGACAATGAAGGG - Intergenic
1107582870 13:41810584-41810606 ATTCACAAAGAGAGACTAGAAGG + Intronic
1107677266 13:42810283-42810305 CTTTAAAATGAGAGAAAGCAAGG + Intergenic
1108194006 13:47973044-47973066 CTTTTAAAAGAGTCACTGGCCGG - Intronic
1109288900 13:60448620-60448642 CTGTAAAAATTGTGACTGGAAGG + Intronic
1110820127 13:79905510-79905532 CTGTAAAAAGACATACTGGATGG - Intergenic
1111334028 13:86798156-86798178 CTTGAAAGATAGAGACTGGACGG - Intergenic
1111858481 13:93670924-93670946 CTTTAAAATTAGAGAATGAAAGG - Intronic
1111952978 13:94724816-94724838 ATTTAAAAACAGAGATTGGCCGG - Intergenic
1112372217 13:98803987-98804009 CTTTAAAAAGAGAGACTGGATGG - Intronic
1113717998 13:112527867-112527889 TTTGCAAAAGAGAGACTGCAAGG - Intronic
1114150476 14:20032768-20032790 AATTTAAAAGAGAGACAGGAAGG - Intergenic
1114465744 14:22921057-22921079 CTGTAAGAAGAAAGACAGGAAGG + Intronic
1114688665 14:24559545-24559567 CTTCAAAATGAGAGAATGGGTGG + Intergenic
1117350486 14:54876786-54876808 CTGCAAAAAGAAACACTGGAAGG + Intronic
1118221288 14:63856651-63856673 CTTTAAAAAGAAAAAAAGGAGGG - Intronic
1119334477 14:73821017-73821039 CTTTAAAAAGGGAGATTTTATGG - Intergenic
1119358561 14:74028065-74028087 CTTCAAAAATAGATACTGAAAGG + Intronic
1119663766 14:76469568-76469590 CATTAAAAAAAGAGACAGGCTGG + Intronic
1119866395 14:77978638-77978660 CTGTGAAATGAGAGAATGGATGG + Intergenic
1119937700 14:78608013-78608035 GTTTAAAAATGGAGACAGGAGGG + Intronic
1121451388 14:94010515-94010537 TTTTAAAAGGAGAGCCAGGAGGG + Intergenic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1123786890 15:23683537-23683559 CTCTAAATAGAAAGACTGGAGGG - Intergenic
1124454652 15:29829864-29829886 CTGTAAAAAGAAACACTGGAAGG + Intronic
1126564837 15:50084336-50084358 CTTTAAAAAGAGATACAAGGGGG + Intronic
1126647194 15:50886119-50886141 CTAGAAAAAGAGACACTGGGTGG - Intergenic
1127112355 15:55688301-55688323 CCTTGAAAAGGGAGACAGGAAGG - Intronic
1127168925 15:56278201-56278223 GTTTAAAAATAGAGAATAGAAGG - Intronic
1127759613 15:62125675-62125697 CCTTAAAAGAAGTGACTGGAAGG - Intergenic
1127852087 15:62922687-62922709 AGTGAAAAAGAGAGACAGGAGGG + Intergenic
1127988204 15:64091761-64091783 CTTTAAAAAGAAAGAAGGGCCGG + Intronic
1128338902 15:66806184-66806206 CTTAAGTAAGAGAGACAGGAAGG - Intergenic
1128414126 15:67428552-67428574 CTTTTAAAAGAGAGGCAGGCCGG + Intronic
1128708437 15:69854342-69854364 CTTTAAATAGAGAGAATAGAAGG + Intergenic
1128812147 15:70580528-70580550 CTTCAAAAAGAGAGAAGGGAGGG - Intergenic
1128861090 15:71072933-71072955 CTTTAAAAAGATAAACAAGATGG + Intergenic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1132924825 16:2423814-2423836 CTTAAAAAAAAAAAACTGGATGG - Intergenic
1133307397 16:4819183-4819205 ATTTAAAAAGAGAGATGGGGGGG + Intronic
1133308246 16:4825183-4825205 CTTTACTATGTGAGACTGGAAGG - Intronic
1134654080 16:15933895-15933917 CTTTTAAAAGATATACTGGTCGG + Intergenic
1135337605 16:21616577-21616599 CTTTGAAAAAAGAGACTGAGGGG - Intronic
1137601876 16:49761821-49761843 CTTTAAAAAGAGAGAGAGACAGG + Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138577814 16:57919719-57919741 CTCTAAAAACAGAGACCAGATGG + Intronic
1138626511 16:58256206-58256228 GTTTAGAAAGAGAGAGAGGAGGG - Intronic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1140127355 16:72129065-72129087 ATTTAAAAAGAAAGACAAGACGG - Exonic
1140415402 16:74770669-74770691 CTTTAAATTGAGAGAGAGGAAGG - Intronic
1141434510 16:83992104-83992126 TGTTAAAAAGAGAGACTGGGGGG + Intronic
1143182552 17:4992708-4992730 CTCTAAAAAGAAAGAAGGGAGGG - Intronic
1144005975 17:11099787-11099809 ATTTAAAAAATAAGACTGGAAGG - Intergenic
1144191200 17:12847799-12847821 CTTTAAAAAGAGTGATGGGCCGG - Intronic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1147269475 17:39257817-39257839 CTTTAAATAGAGGGAAAGGATGG + Intergenic
1147463546 17:40591822-40591844 CTGTTAAAAGAGAAACTGGCCGG - Intergenic
1148022845 17:44565047-44565069 CTTTTATAATAGAGACTGGGAGG - Intergenic
1148039057 17:44691611-44691633 CTTTACATAAAGGGACTGGAGGG + Intergenic
1148163323 17:45464357-45464379 TTTTTAAAAGAAAGACTGAATGG + Intronic
1149938838 17:60841290-60841312 GTTGCAAAAGAGAGACTGGATGG + Intronic
1149967957 17:61186674-61186696 CTCTAAACAGAGAAACTGGGTGG - Intronic
1150394554 17:64811009-64811031 TTTTTAAAAGAAAGACTGAATGG + Intergenic
1151116744 17:71744136-71744158 TTTTAAAAAGAGGGACAAGAAGG - Intergenic
1151462594 17:74263433-74263455 CTTTAAAAATAAATACTGCAGGG + Intergenic
1152042005 17:77909673-77909695 GTGTAAAATTAGAGACTGGATGG - Intergenic
1152157831 17:78646404-78646426 CTTTAAAAAGAAAGGCTGTCGGG + Intergenic
1152309639 17:79541968-79541990 CTGTAAAAAGAAACACTCGAGGG - Intergenic
1152670487 17:81601707-81601729 TTTTAAAAAGAGACACTAGATGG - Intronic
1152986619 18:327338-327360 ATTTCAAAAGAAAGACTGGCAGG - Intronic
1153132465 18:1871630-1871652 TGTTAAAAAGAAAGAATGGAAGG + Intergenic
1155110958 18:22713977-22713999 CTTTTAAGAGAAAGACTTGATGG + Intergenic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1155874162 18:31064351-31064373 CTTTTAAAACAGAGACTAGAAGG - Exonic
1156860920 18:41835449-41835471 TTTTAAAGATAGAGAATGGATGG - Intergenic
1157286407 18:46380174-46380196 CTATAAAATGGAAGACTGGATGG + Intronic
1157630108 18:49086690-49086712 CCCTCAAAAGAGAGACTGCAGGG + Intronic
1158143513 18:54283510-54283532 CTTGAGAGAGAGAGAATGGAAGG - Intronic
1159103216 18:63978016-63978038 CTTAAAAGAGAGAGGCAGGAGGG - Intronic
1159279038 18:66260403-66260425 CTTTGAACTGAAAGACTGGAAGG + Intergenic
1160082625 18:75743724-75743746 CTCTAAATAGTGAGACTGAATGG - Intergenic
1160631531 18:80249774-80249796 CTTTTAAAGGAAAGGCTGGAAGG + Intergenic
1160984512 19:1832099-1832121 CTTTAAAGAGGGAGGCAGGAGGG + Intronic
1161074793 19:2280368-2280390 CATTAAAAAGAGAGAGAGGCTGG - Intronic
1161497059 19:4592429-4592451 ATTTAAAAAGAGAAAATGAAGGG + Intergenic
1163133646 19:15293218-15293240 CTTTAACAAGCGAAACTGTATGG - Intronic
1163146694 19:15384599-15384621 ATTTAAGAAGAAAGACTTGAGGG - Intronic
1163190210 19:15672189-15672211 CTCCAAAAAGAGGGACTGAAGGG - Intergenic
1163202963 19:15781245-15781267 CTCCAAAAAGAGGGACTGAAGGG + Intergenic
1163491518 19:17619726-17619748 CTTTAAAAGGTCAGACTGGCTGG - Intronic
1163574317 19:18101629-18101651 CTAAAAAAAGAGAGACTCAAAGG - Intronic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
1165452688 19:35893838-35893860 CTTGAAAGTGAGAGAGTGGATGG + Intronic
1165604757 19:37092353-37092375 CTTTCAAAAGAGGGAATGGTTGG + Intronic
1165842346 19:38796402-38796424 GTTTAAAAAGAGAGCCTGCCAGG - Intergenic
1167472179 19:49681439-49681461 TTTTAAAAAGGGAAACTGGCTGG + Intronic
1167824473 19:51959773-51959795 TTATAAAAAGAAACACTGGACGG + Intergenic
926390884 2:12391427-12391449 CTATAAAAAGAGAGTGAGGAGGG - Intergenic
926986128 2:18626070-18626092 TTCTAAAAAGAGAGAAAGGAAGG + Intergenic
927338636 2:21954243-21954265 CTTCAAAAACAAAGACTGTAAGG + Intergenic
927659196 2:24978221-24978243 CTATAAAAAGAAACACAGGAAGG - Intergenic
928042575 2:27892791-27892813 CTTTGAAATGAGAGACTAGTCGG + Intronic
928505237 2:31944817-31944839 GTTTTAAAAGAAAGAATGGATGG - Intronic
929417322 2:41756579-41756601 CTTTAAAATGAGAAACTTGCTGG - Intergenic
929435877 2:41927924-41927946 CTTTAGAAGGATAGGCTGGAGGG + Intergenic
929524425 2:42687185-42687207 CTATAAAAGGGGAGACTTGACGG - Intronic
929819148 2:45259492-45259514 CTTTGAAAAGAGAGACCTGCAGG + Intergenic
929995596 2:46824438-46824460 TTTTTAAAAAAAAGACTGGAAGG + Intronic
930146969 2:48017231-48017253 CTTTAAAAAGAAAGGTTGGCCGG - Intergenic
931248798 2:60512578-60512600 TTGTAAAAAGTGAGACTAGATGG + Intronic
932538682 2:72627684-72627706 CTCCAAAAAGAGAGATTGCATGG - Intronic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
933331081 2:80893901-80893923 CTTTGCAAACAGAGAATGGAGGG + Intergenic
933637475 2:84723470-84723492 CTTAAAAAAGAGAGAAGGGCAGG - Intronic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934636106 2:95991516-95991538 CATCAATAAGAGAGACAGGAAGG - Exonic
935417295 2:102832442-102832464 CTTTAAGAATAAAGCCTGGAAGG - Intronic
936937010 2:117848336-117848358 CTTAAAAAAAAGAGAATGAAAGG + Intergenic
937357644 2:121208330-121208352 TTTTAAAAAAAGAGACTTTAGGG + Intergenic
939818618 2:146927848-146927870 ATTTGAAAAGAGAGAGAGGAAGG + Intergenic
939891303 2:147739592-147739614 CTATCAGAAGAGAGACTAGAGGG - Intergenic
940307608 2:152243364-152243386 TTTTAAAGAGGGAGACTGGAAGG - Intergenic
940826450 2:158417599-158417621 CTGTGAAAGGAGAGACGGGAAGG - Intronic
941290946 2:163673839-163673861 CTTTAAAAATAAAGACTTAAAGG + Intronic
941394743 2:164960643-164960665 ATTTAAAAAGAGAGAAAGTAAGG - Intergenic
941736574 2:168983473-168983495 CTTTAAAGAGATAGTATGGATGG - Intronic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942820270 2:180105501-180105523 TTTTATATAGAGAGACTGGGAGG + Intergenic
942853228 2:180515900-180515922 CCTGAAAAAGAGAGAGTAGATGG - Intergenic
945149523 2:206774203-206774225 CCTTAAAAAGAGAAAATTGAGGG - Exonic
945781393 2:214177349-214177371 CTTTAAAAAGATTGACTTAATGG + Intronic
946415710 2:219538715-219538737 CTTTATAAAATCAGACTGGAGGG - Exonic
947827024 2:233113385-233113407 TTTTAAAAAAAGAGAAGGGAGGG + Intronic
947896251 2:233675744-233675766 CTTTAAAAAGATAGAATAAAGGG - Intronic
1169078341 20:2776947-2776969 CTTTAAGAAGAGAGAGAGGCTGG - Intergenic
1169893523 20:10478193-10478215 CTTTTAAAAGAGAGCTTGGCCGG - Intronic
1170879258 20:20280176-20280198 CCTTAAATAGAGAGATTTGATGG + Intronic
1170925228 20:20716726-20716748 TTTCAAAAAGAAACACTGGAAGG + Intergenic
1174295778 20:49544093-49544115 CTGTAAAAGGAGACACTGGCTGG - Intronic
1174592375 20:51656582-51656604 CTTTAAATAGGTAGACTGTATGG + Intronic
1175164261 20:57031791-57031813 ATTTAAAAAGAGAAAAAGGAAGG - Intergenic
1176546512 21:8204574-8204596 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1176554406 21:8248765-8248787 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1176565463 21:8387621-8387643 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1176573328 21:8431789-8431811 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1176677186 21:9790281-9790303 ATTTGAAAAGAGAGAGGGGATGG + Intergenic
1178971583 21:37182707-37182729 TTTTAACAAAAGAGACTGAAAGG - Intronic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1181565667 22:23735662-23735684 CTTAAAAAAGAAAGAAAGGAAGG + Intergenic
1181854087 22:25769799-25769821 CTTTGAAATGAGAGACTCCATGG - Intronic
1182020130 22:27074819-27074841 CTCTACAATGAGAGACTGAAAGG + Intergenic
1183290846 22:37000894-37000916 CTTTAAGATGACAGAGTGGAAGG + Intronic
1183946746 22:41330638-41330660 GATTAAAAAGAGAGAATGGATGG + Intronic
1203251375 22_KI270733v1_random:120836-120858 TTTTTAAAAGACAGACGGGAAGG - Intergenic
949932941 3:9093717-9093739 CTTTGAAAAGAGATTTTGGATGG - Intronic
949995787 3:9615674-9615696 CTCTAAAAAAAGAGAAAGGAAGG + Intergenic
950382057 3:12624699-12624721 ATTTAAAAAGAGAGACATGTTGG + Intronic
950398804 3:12754411-12754433 TTTTAAAAAGATAATCTGGAAGG + Intronic
951115589 3:18857981-18858003 CTTAAAAAAGAGATACTTAACGG + Intergenic
951791355 3:26488211-26488233 CTTTAAATTAAGAAACTGGAGGG + Intergenic
951911465 3:27754803-27754825 CATACAAAAGAGAGACTGGAAGG - Intergenic
952111639 3:30130521-30130543 TTTTAAAAAGAGAGAAGGGGAGG - Intergenic
952429379 3:33207228-33207250 CAATATGAAGAGAGACTGGAGGG + Intronic
952600372 3:35072765-35072787 TTGTAAAAATAGAGACTGAATGG - Intergenic
955028205 3:55190617-55190639 CTTAGAAAAGAAAGCCTGGATGG - Intergenic
955675282 3:61441904-61441926 CTTTAAAAAGAGAGTCTTATGGG - Intergenic
955965311 3:64382981-64383003 CCTTTATAAAAGAGACTGGAGGG + Intronic
956033736 3:65067633-65067655 ATTTAAAAAAAAAGACTGAAGGG - Intergenic
956315134 3:67927049-67927071 GCTTAAAAAGAGGGACTGGAAGG + Intergenic
956899806 3:73703703-73703725 CTTATAAAAGAGAGGCTGGAGGG - Intergenic
957229815 3:77498572-77498594 CTTTAAGAAAAGAAACTGAATGG + Intronic
957365511 3:79217696-79217718 ATTTAAAAAGAGAGTTTTGATGG + Intronic
957411978 3:79853104-79853126 ATTTAGAAACAGAGAATGGAAGG - Intergenic
957523597 3:81351990-81352012 CTTTAAAAATAGAGCATGGCTGG + Intergenic
957782567 3:84838261-84838283 TTTTAAAAAAAGAAACTGGCTGG - Intergenic
957878143 3:86175731-86175753 CATTTAAAAGTGAGACTGCATGG + Intergenic
957901524 3:86500088-86500110 CTTTAAATAGATAAACTAGAGGG + Intergenic
958134245 3:89466852-89466874 ATTAAAAAAGAGAGACAGGAGGG - Intronic
960023381 3:112980998-112981020 CTTATAAAAGATAGACAGGATGG - Intergenic
960255890 3:115511270-115511292 CTTTAAAGAAGGAGGCTGGAGGG + Intergenic
960259842 3:115554367-115554389 CTTTAGATAGGGAGACTTGATGG + Intergenic
961245373 3:125447846-125447868 CTTTAAAATGTGAGTTTGGAAGG + Intronic
961991042 3:131191386-131191408 CTTTGAAAATAGAGAAAGGAGGG - Intronic
963860444 3:150304341-150304363 CTTTAAAAAAAGATACATGAAGG - Intergenic
963885639 3:150579411-150579433 CTTTAAAAAGAAAAATTGGCTGG + Intronic
964033751 3:152170120-152170142 TTTAAAGAAGAGAGACTGGATGG - Intergenic
964074542 3:152677382-152677404 GCTTAAAAACACAGACTGGAAGG - Intergenic
964080678 3:152752294-152752316 TTTAAAAAAGAGAAACTGGCAGG + Intergenic
965534325 3:169809438-169809460 CTTTAGAAAGAGGAAATGGAAGG - Intronic
965767544 3:172147005-172147027 CTTTAAAAAGTGAGATGAGAAGG + Intronic
966245736 3:177805605-177805627 CTTGAAGAAGAAAGACTGAATGG - Intergenic
967111142 3:186295070-186295092 CAGCAAAAAGAGAAACTGGAAGG - Intronic
967778769 3:193413063-193413085 CTTTGAACAGAGGGACTGGCTGG + Intronic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
969165087 4:5301303-5301325 CTTTCAAAAGATAGAATAGAGGG - Intronic
969557285 4:7920719-7920741 CTTTCAAAATAGAGATTCGAAGG - Intronic
970388348 4:15579945-15579967 CTTCAAAAAGAAAGACTTCATGG - Intronic
970814237 4:20135084-20135106 CTTGAAAAAGAAAAACTTGAAGG + Intergenic
971088720 4:23313615-23313637 ATTTAAAAAGAAATACTGAAAGG - Intergenic
971507492 4:27382037-27382059 CTTCCAACAGAGAGACTGGCAGG + Intergenic
972716221 4:41649076-41649098 CTTTTAAAAGAAATAATGGAAGG - Intronic
973106115 4:46340184-46340206 TTTTAAAAAAAGAGACTGTAGGG - Intronic
973168530 4:47109540-47109562 CTATACAAATAGAGACTGCAAGG + Intronic
973931571 4:55798108-55798130 GCTGAAGAAGAGAGACTGGAAGG - Intergenic
974742320 4:66022389-66022411 CTTTAAACAAAGAGACTGGTGGG - Intergenic
975188425 4:71430985-71431007 CTTTAAGAAGAGAGTTAGGAAGG + Intronic
975460222 4:74643801-74643823 CTTATAAAAGAGAGACCGGCCGG + Intergenic
975460270 4:74644141-74644163 TTTTAAAAAGAGAGACCAGAGGG + Intergenic
975872892 4:78801082-78801104 CATTACACAGAGAGACTGCAGGG - Intronic
976049203 4:80991190-80991212 CTTCAAAGAGAGAGACTGGGTGG + Intergenic
976200839 4:82577212-82577234 CTTTAAAAAGAAAAACTAAAAGG - Intergenic
976435625 4:85014479-85014501 CTTTGAAGAGAGAGGCTGGTGGG - Intergenic
977811954 4:101366633-101366655 CTTTCAATAGGGTGACTGGAGGG + Intergenic
978873737 4:113612016-113612038 ATTTAAAATAAGAGAGTGGAAGG - Intronic
978920067 4:114173418-114173440 CTCTAATAAAAGAGACTGAAGGG + Intergenic
979069031 4:116177410-116177432 CTTAAAGAAGAGAAACTTGAAGG - Intergenic
979541956 4:121894241-121894263 CTTTAAAAAGAGACAAAGAAAGG + Intronic
980785853 4:137553815-137553837 CTTACAAAAGAGAGACGGAAGGG - Intergenic
980799509 4:137731477-137731499 CTATAAAAAGGAAGACAGGAAGG - Intergenic
983111210 4:163751899-163751921 CTTAAAGAAGAGAAACTAGATGG + Intronic
983299312 4:165904870-165904892 CATCAAAAAGAGAAATTGGACGG + Intronic
984445274 4:179828820-179828842 CTTTAAAAGAAAAGGCTGGAAGG - Intergenic
985398359 4:189568499-189568521 ATTTGAAAAGAGAGAGGGGATGG - Intergenic
985827530 5:2204193-2204215 TTTTAAAAAAAGAGACAGCAAGG + Intergenic
986095520 5:4550213-4550235 ATTCAGAAAGAGACACTGGAAGG + Intergenic
986221139 5:5770148-5770170 CTTTAAAAATAGAGATTGATGGG + Intergenic
986780144 5:11057899-11057921 ATTTTAAAAAAGAGACTGGCAGG + Intronic
987632175 5:20488312-20488334 CTTTAAAAAGAAACAGTTGAAGG + Intronic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
988015531 5:25553221-25553243 ATTGGCAAAGAGAGACTGGATGG - Intergenic
988467553 5:31505044-31505066 TTTCAAAAAGAGAAACTGTAAGG + Intronic
990735473 5:58856255-58856277 CTCCAAACAGAGAGAGTGGAGGG + Exonic
990837111 5:60034495-60034517 CTTTTAAGAGAGAGGCAGGAAGG - Intronic
990842028 5:60092578-60092600 ATAAAAAAAGAGAGAATGGAGGG + Intronic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
992488829 5:77221267-77221289 TATAGAAAAGAGAGACTGGAAGG - Intronic
993841147 5:92880360-92880382 CTCTAAAGAGAGAAACTGCATGG - Intergenic
993940910 5:94057949-94057971 GTTTAGAAAGAGAGACTGCTGGG + Intronic
994016229 5:94969115-94969137 CTTTAAAAAGAGGAATTGGACGG + Intronic
994617405 5:102121835-102121857 CTTGAGAAAGAGAGAAAGGAGGG - Intergenic
995459289 5:112386051-112386073 CTTTAAAAAGATAGAATGCTAGG - Intronic
995488511 5:112664241-112664263 CTTTAAAAAGCAAGAATTGAGGG + Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
996366288 5:122704554-122704576 CTTTTAAAAGATAGGCTGTATGG + Intergenic
997392981 5:133532096-133532118 CTTCTAAAAGAGAGGCAGGAGGG + Intronic
998029198 5:138849923-138849945 CTGTAAGAAGAGAAACTGAATGG - Intronic
998914614 5:147000353-147000375 CTTTAAACAGAGAGGCAGTAGGG + Intronic
999105085 5:149063486-149063508 CTTTGCAGAGAGAGACTGGGTGG - Intergenic
999404874 5:151298105-151298127 CTTTAAAAAGACAGAAATGAGGG + Intronic
999728012 5:154453018-154453040 ATTTAAAAGGTGAGAATGGATGG - Intronic
999872153 5:155763960-155763982 ATTTGGAAAGAGAGACTGCAGGG + Intergenic
999936850 5:156495878-156495900 CTTTAAAAAGAGACATTGGTGGG - Intronic
1000216479 5:159162348-159162370 TTTGAAAAAGAGAAACTGAAAGG + Intronic
1000963426 5:167627330-167627352 CTTTGAAAAGAGAGAATGTGAGG + Intronic
1001092932 5:168754763-168754785 ATTTAAAAAAACAGGCTGGATGG + Intronic
1001170166 5:169411773-169411795 ATTTAAAAAAAAAGATTGGAGGG + Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1002589214 5:180277436-180277458 CTTACAAAAGGGAGACAGGAAGG - Intronic
1002811614 6:636536-636558 CTTTAAAAAGAAAAAGTGAACGG - Intronic
1002908439 6:1469736-1469758 TTTAAAAGAGAGAGACAGGAAGG - Intergenic
1003032409 6:2613442-2613464 CTTGTAAAAGAGAGGCAGGAGGG - Intergenic
1003153814 6:3574536-3574558 CTCTAAAAAGACAGGCTGGCCGG - Intergenic
1004767225 6:18743839-18743861 GTATTAAAAGAGAGACTAGAAGG - Intergenic
1006023178 6:31129910-31129932 CTTAAAGAAGAGAGAAAGGAGGG - Intronic
1008359746 6:50601630-50601652 GTTTAGGAAGAGAGACTGGCTGG + Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1009660850 6:66608949-66608971 CTCTAAGAACATAGACTGGATGG + Intergenic
1010221945 6:73455425-73455447 CTTTAGAAATAGATACTTGAAGG - Intergenic
1010971999 6:82272931-82272953 GTTTAGAATGAGAGACTGGGAGG + Intergenic
1012391626 6:98747477-98747499 CCTTAGACAGAGAGAGTGGAGGG + Intergenic
1012634941 6:101526319-101526341 TTTTAAAAATAGAAATTGGATGG + Intronic
1012893400 6:104922165-104922187 GTTTGAAGAGAGAGACAGGAGGG - Intergenic
1013403441 6:109820662-109820684 TTTTAAAAATAGAGCCTGGTCGG + Intronic
1014410081 6:121104365-121104387 CTTTAGAAACCAAGACTGGAAGG + Intronic
1014599780 6:123396531-123396553 CTTTTAAATCAGAGACAGGATGG + Intronic
1016366350 6:143322622-143322644 CTTTAGAAAGTGGGACTGCATGG + Intronic
1017630222 6:156389726-156389748 CTTTAAAAAATGAAACTTGAAGG + Intergenic
1018236918 6:161735614-161735636 TTTTTAAAAGTGAGACTGTAAGG + Intronic
1018641030 6:165904218-165904240 CTTTGAGAAGAGAGAGGGGACGG + Intronic
1020544194 7:9502657-9502679 TTTTAAAATAACAGACTGGATGG + Intergenic
1022365425 7:29710333-29710355 TTTTAAAAAGCAAGACTGTATGG - Intergenic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1022936035 7:35178115-35178137 CTCTGAAAACAGAGATTGGATGG + Intergenic
1023187310 7:37545643-37545665 TTTTTAAAGGAGACACTGGAAGG + Intergenic
1023396352 7:39755156-39755178 TTTTAAAAAGAGAAACTGAGAGG + Intergenic
1024818914 7:53304098-53304120 CTGGAAAGTGAGAGACTGGAAGG - Intergenic
1025752698 7:64307240-64307262 CTTTAGAAAGAGAGGCAGGGCGG - Intergenic
1026917850 7:74132918-74132940 ACTAAAAAAGAGAGACGGGAAGG + Intergenic
1027542605 7:79486871-79486893 TTCTAAAAAGAAACACTGGAGGG + Intergenic
1027910868 7:84248748-84248770 TTTTAAAAAGAGAGAGAGGGAGG - Intronic
1027921117 7:84396123-84396145 TTTTAAAAAGAAAGACTAGCAGG + Intronic
1028021581 7:85782257-85782279 TTTTAAAAAGAGTGATTGAATGG + Intergenic
1028461538 7:91098781-91098803 CTTTAAAAAGCGTGACAGCAAGG + Intronic
1028717413 7:93987385-93987407 GTTTAAAAAGAGAAACTTGCAGG + Intronic
1029831997 7:103270832-103270854 CTCTGAAAACAGAGATTGGATGG + Intergenic
1030020767 7:105273245-105273267 TATAAAAAAGAGAGAATGGAGGG - Intronic
1030576388 7:111291419-111291441 CTGTCAAAAGTAAGACTGGATGG - Intronic
1031113086 7:117635754-117635776 CTATAATACAAGAGACTGGAAGG - Intronic
1031425292 7:121597860-121597882 CTTAAAACAAAGAGACTTGAAGG + Intergenic
1032219773 7:129985472-129985494 TTTTAAAAACAGAGACAGGAAGG - Intergenic
1033822643 7:145152680-145152702 CTCAAAAAAGAAAGACTGGAGGG - Intergenic
1035396089 7:158535763-158535785 GTTTAAAAAAAAAGACTGGAAGG + Intronic
1037385581 8:18336799-18336821 CCTTAAAATGAGAGATTGTAAGG - Intergenic
1037691190 8:21183063-21183085 ATTCATAAAAAGAGACTGGATGG + Intergenic
1038410541 8:27355248-27355270 CTTTTAAGAGAGAGGCAGGAAGG + Intronic
1038474221 8:27852611-27852633 CTTTCAAAAGAAAGACATGAGGG - Intergenic
1038720443 8:30030598-30030620 CTTTAAAAAGAAAGAAGAGAGGG + Intergenic
1038736225 8:30172117-30172139 CTTTTAAAGGAGAAACTGTAAGG - Intronic
1038867768 8:31458368-31458390 GTTGAAAAAGAGAGAGTAGATGG + Intergenic
1040600006 8:48873414-48873436 CATTAAAAAAACACACTGGAGGG + Intergenic
1040833213 8:51702066-51702088 GTTTCAAAAGTGAGCCTGGATGG - Intronic
1041026550 8:53692771-53692793 CTTTAAATAGAGTGAGTGCAAGG - Intergenic
1041052157 8:53945574-53945596 CTTTAAACAGATAAACTTGACGG + Intronic
1041070085 8:54119817-54119839 CCTTATAAAGAAAGACTGCAGGG + Intergenic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041603699 8:59754601-59754623 CCTTAAAAAGAGAGCCTGAGGGG + Intergenic
1041825420 8:62090387-62090409 CTTTATCATGAGAGACTGGAGGG + Intergenic
1042401916 8:68359641-68359663 CCTTAAAAAGAGAGAGGGGTGGG - Intronic
1042695697 8:71552859-71552881 TTATAAAAACATAGACTGGATGG + Intronic
1043366612 8:79540524-79540546 CTTTTAAGAGAGAGACTCCAAGG + Intergenic
1044347826 8:91126693-91126715 TGTTCAAAAGAGAGAATGGAGGG + Intronic
1044420316 8:91987758-91987780 CACTAAAAAGAGAGGCTGAAAGG + Intronic
1045987880 8:108270662-108270684 GTTTAAAAAGATATATTGGAAGG - Intronic
1046264865 8:111817514-111817536 CTTATAAAAGAGATGCTGGAGGG - Intergenic
1046425223 8:114038799-114038821 CTTAAACAATATAGACTGGATGG + Intergenic
1047410967 8:124624364-124624386 TTGTAAAAAGAGAAACTGGGAGG + Intronic
1047606459 8:126479565-126479587 ATTTAACAAGACAGACTAGAAGG + Intergenic
1049519488 8:143080730-143080752 GTTTAGAAAGAGAGATTGGAAGG + Intronic
1050419231 9:5445746-5445768 CTTTTAGAAGAGAGACTCGAAGG - Intergenic
1050548106 9:6726218-6726240 TTTTAAAAAGAGAATCTGGCCGG - Intronic
1050557455 9:6801548-6801570 CTTAAAAAAAAAAGATTGGAGGG + Intronic
1052983648 9:34468527-34468549 TTGTAAAAAGAGAGCCTGGCTGG + Intronic
1053003085 9:34588606-34588628 TCTCAAAAAGAGAGACTAGACGG + Intronic
1053510065 9:38680204-38680226 TTTTAAAAAGAGAGAATGGGTGG + Intergenic
1054753391 9:68931624-68931646 CATTAAGAAGAGAGACAGGAAGG + Intronic
1055262461 9:74453719-74453741 ATTTAAAAAAGGAGACTGGCAGG - Intergenic
1056112557 9:83410118-83410140 ATTTAAAAAGAGAGAATTTAGGG - Intronic
1056238399 9:84618935-84618957 GTTTAAAAAGAGAGAGAGAAAGG + Intergenic
1056512840 9:87321949-87321971 CTTTAAAAAGAAAGTCTGCCTGG - Intergenic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1057527642 9:95816776-95816798 GTGCAAAAAGACAGACTGGAGGG + Intergenic
1058360707 9:104143137-104143159 CTCTAAAAAGAGAAAATGGCTGG - Intergenic
1058624072 9:106915898-106915920 CTATAAGAAAATAGACTGGAAGG + Intronic
1059968275 9:119637819-119637841 CTGGATAAAGAGTGACTGGAGGG + Intergenic
1060452809 9:123759095-123759117 CTTTAAAAAAAGAGTTTGGCCGG - Intronic
1061628767 9:131858107-131858129 TTTTGAAAACAGAGACTGGCGGG + Intergenic
1061685387 9:132272447-132272469 CTTTAAAAATAAAGACTGTAAGG - Intronic
1062095363 9:134700347-134700369 CTTTACAAAGGGATAATGGAGGG - Intronic
1203467777 Un_GL000220v1:103987-104009 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1203475602 Un_GL000220v1:147963-147985 TTTTTAAAAGACAGACGGGAAGG - Intergenic
1186673347 X:11789812-11789834 TTTTTAAAAAAGAGACTAGAAGG - Intergenic
1187034356 X:15522242-15522264 CTTGAAAGAGAGAGAAAGGAAGG - Intronic
1187350818 X:18515261-18515283 CTTGATAGAGAGAGGCTGGAGGG + Intronic
1189073451 X:37889100-37889122 ATATTAAAAGAAAGACTGGAAGG + Intronic
1189441868 X:41044025-41044047 CTTTAAAAAGATTTACTGGTTGG - Intergenic
1190489460 X:50967031-50967053 CTTAAAGAAGAGAGAATGGCTGG + Intergenic
1190569994 X:51770935-51770957 CTTTAAAAGGAGGAACTGGCTGG - Intergenic
1192474141 X:71424919-71424941 CTTTAAAAAAAAAGACTGGCTGG - Intronic
1192480337 X:71479827-71479849 CTGAAAAAAAAGTGACTGGAAGG + Intronic
1193581608 X:83271325-83271347 CTTTTAGAAGATAGACTCGAAGG - Intergenic
1194656483 X:96580212-96580234 ATTTAAAAAGAAACATTGGAAGG + Intergenic
1194715173 X:97279616-97279638 TTTTAGAAACAGAGACTGGATGG - Intronic
1195267362 X:103195831-103195853 CTTTAAAAATAGATAGTGGCCGG + Intergenic
1195873084 X:109506830-109506852 ATTTAAAATCATAGACTGGACGG + Intergenic
1196788620 X:119444049-119444071 CTTTAAAAATATAGAATGGCTGG - Intronic
1198424783 X:136506236-136506258 CTTTAAAAATATTCACTGGAGGG - Intronic
1199012723 X:142776716-142776738 CTTGACAAAGTCAGACTGGAAGG + Intergenic
1200683141 Y:6236280-6236302 CTTTAGAAGCAGAGACTGAAAGG - Intergenic
1201049491 Y:9918106-9918128 CTTTAGAAGCAGAGACTGAAAGG + Intergenic