ID: 1112373970

View in Genome Browser
Species Human (GRCh38)
Location 13:98821406-98821428
Sequence GCCCCGAGGTTAGCAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112373970_1112373972 -3 Left 1112373970 13:98821406-98821428 CCAGCTGCTGCTAACCTCGGGGC 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1112373972 13:98821426-98821448 GGCACTGCAACATCCCTTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112373970 Original CRISPR GCCCCGAGGTTAGCAGCAGC TGG (reversed) Intronic
900250392 1:1665746-1665768 GTCACGAGGACAGCAGCAGCTGG + Exonic
900368083 1:2319624-2319646 GCCTCGAGGATGGCCGCAGCTGG + Intergenic
901060720 1:6470782-6470804 GCACCGACTTGAGCAGCAGCGGG + Exonic
902680016 1:18036655-18036677 GCCCTGGGGTTGGCAGGAGCGGG + Intergenic
904905635 1:33895533-33895555 GACAAAAGGTTAGCAGCAGCAGG + Intronic
906114855 1:43349573-43349595 TCGCCGAGGTGAGCAGCAGGAGG - Intronic
907277040 1:53322461-53322483 GCCTGGAGGTGAGAAGCAGCAGG + Intronic
907643067 1:56212172-56212194 CCCCAGAGATTAGCAACAGCAGG + Intergenic
908267660 1:62394995-62395017 CCCCAGGGGTTAGTAGCAGCTGG - Intergenic
915796224 1:158736591-158736613 TCCCTGAGGTTAGAAACAGCTGG - Intergenic
920227881 1:204451082-204451104 GCCCCCAGGGTAGAGGCAGCTGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063123349 10:3120076-3120098 GCCCCGGGGTTAGCGTCAGCCGG - Intronic
1065986101 10:30953703-30953725 GACCAGAGGTGAGCAGAAGCTGG + Intronic
1067769768 10:49115123-49115145 GCCCCGAGGGGAGATGCAGCAGG - Intronic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1073099514 10:100999518-100999540 GCCCCGGGGCCAGCGGCAGCTGG - Exonic
1073345739 10:102781604-102781626 GGCCCGAGGGTAACAGCAACTGG - Intronic
1074142871 10:110690558-110690580 GCCTAGAGGTTAGCAGGAGCTGG - Intronic
1074233900 10:111565677-111565699 ACCCAGAGATTAGCAGTAGCAGG + Intergenic
1074772333 10:116742269-116742291 GGGCCGGGGTCAGCAGCAGCGGG - Intronic
1075079318 10:119372129-119372151 GCTCAGAGGTTTTCAGCAGCGGG - Intronic
1076055673 10:127370327-127370349 GCTCCGAGGTTATCAAGAGCCGG - Intronic
1076274116 10:129182165-129182187 GCTCCGAGGCTAGGAGAAGCTGG - Intergenic
1077265768 11:1648724-1648746 ACCCCGCGGTGAGCAGCAGAAGG - Intergenic
1079189195 11:18263900-18263922 GCCCAGAGTGTAGCAGGAGCAGG - Intergenic
1083031432 11:59596603-59596625 ACCCAGAGATTAGCAGCAACAGG + Intronic
1083475053 11:62910053-62910075 GCCCCGTGGAAAGGAGCAGCTGG - Exonic
1083567932 11:63736236-63736258 GCCATGAGGTTAGCACCCGCAGG - Intronic
1083609197 11:63997148-63997170 AGCCCGAGGTGAGCAGCCGCAGG - Exonic
1083765452 11:64839333-64839355 GGCCCCAGGTGGGCAGCAGCAGG - Intronic
1083896196 11:65620959-65620981 TCCCGGAGGTGAGGAGCAGCCGG + Exonic
1087716313 11:101612694-101612716 GCCCAGAGATTAGCAGCAGCAGG - Intronic
1088131820 11:106501032-106501054 GACCAGTGGTTACCAGCAGCAGG - Intergenic
1088250919 11:107860107-107860129 ACCCCAAGTTTAGCAGCTGCAGG + Intronic
1089556188 11:119317039-119317061 GACGCGAGGACAGCAGCAGCAGG + Exonic
1090064412 11:123490883-123490905 GCGAGGAGGTTAGCGGCAGCAGG + Intergenic
1090457309 11:126861263-126861285 GCCCAGAGGTTAGTAACAGTAGG + Intronic
1090917082 11:131174930-131174952 GGAAGGAGGTTAGCAGCAGCTGG - Intergenic
1093805147 12:23423151-23423173 ACCCCAAGGTTAGCAACAGAAGG + Intergenic
1095310522 12:40692564-40692586 GCACCGAGGCGAGCAGGAGCAGG + Exonic
1096070841 12:48774720-48774742 GCACGGTGATTAGCAGCAGCAGG + Exonic
1100476218 12:94938113-94938135 TACCAGAGGTTAGGAGCAGCGGG + Intronic
1102603282 12:114049565-114049587 ACCCAGAGATTAGCAACAGCTGG - Intergenic
1103308771 12:119988781-119988803 GCCTGGAGGTGAGCAGCAGGCGG + Intergenic
1103532453 12:121611726-121611748 GCCCCCAGGTTAGCCCCAGCAGG - Intergenic
1111597398 13:90428594-90428616 GCTCCGTGGTAAGCAGCAGCTGG - Intergenic
1112179056 13:97058599-97058621 GCCAAGAGATTAGCAGCAGCAGG - Intergenic
1112373970 13:98821406-98821428 GCCCCGAGGTTAGCAGCAGCTGG - Intronic
1113062033 13:106332193-106332215 GACAAGAAGTTAGCAGCAGCTGG + Intergenic
1113524571 13:110964684-110964706 GCCCCGAGGTTGGGCTCAGCAGG + Intergenic
1113701471 13:112392095-112392117 GCCCCGAGGTTGGGCTCAGCAGG - Intronic
1114051799 14:18925334-18925356 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1114053700 14:18946175-18946197 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1114108857 14:19455750-19455772 ACCCAGAGATTAGCAGCAGCAGG + Intergenic
1114110760 14:19476587-19476609 ACCCAGAGATTAGCAGCAGCAGG + Intergenic
1114457455 14:22865470-22865492 GCCCAGAGATAAGCAACAGCAGG + Intergenic
1115726485 14:36223001-36223023 GCTCCGAGGTTTCCAACAGCCGG + Intergenic
1119748557 14:77061792-77061814 GCCCCGAGGTGGGCAGGCGCAGG + Intergenic
1121216873 14:92255138-92255160 GCCCAGATTTTAGCAACAGCAGG - Intergenic
1121489704 14:94349015-94349037 TCCCAGAGGTTAGCAAAAGCAGG - Intergenic
1121573826 14:94967210-94967232 GCCACAAAGTTGGCAGCAGCAGG - Intergenic
1124610459 15:31204488-31204510 GATCCCAGGTTAGCAGCAGTGGG - Intergenic
1126359229 15:47828818-47828840 ACCCAGAGATTAGCAACAGCAGG + Intergenic
1127544406 15:59976774-59976796 ACACAGAGGTTAGCAGTAGCAGG - Intergenic
1129655873 15:77525542-77525564 GCCCCGAGGAAAGAATCAGCAGG + Intergenic
1129752656 15:78077025-78077047 GGCCCGAGGTTAGGCGCAGAGGG + Intronic
1130061251 15:80571720-80571742 GCCCCTAGGCTAGCAACAACAGG - Intronic
1130960695 15:88657010-88657032 GCCCCCGGGCCAGCAGCAGCGGG - Intergenic
1131691994 15:94837238-94837260 ACCCAAAGGTGAGCAGCAGCAGG + Intergenic
1136624435 16:31453407-31453429 GCCCAGAGCTAAGCAGAAGCAGG + Intergenic
1137001734 16:35235182-35235204 GCCCCCAGCTGAGAAGCAGCAGG - Intergenic
1137018021 16:35395048-35395070 GCCCCCAGCTGAGAAGCAGCAGG - Intergenic
1137236233 16:46620993-46621015 GCCCCGAGGTTGGAGGGAGCTGG - Intronic
1137693764 16:50447736-50447758 GCCCAGAGGTTAGCAACTGTGGG + Intergenic
1140891260 16:79287294-79287316 GCCCCTAGCTGAACAGCAGCTGG - Intergenic
1141143988 16:81516047-81516069 ACCCAGAGATTAGCAACAGCAGG - Intronic
1146062475 17:29614423-29614445 CCACAGAGGCTAGCAGCAGCTGG - Exonic
1146454091 17:32995937-32995959 ACCCCGACTTTAGCAGCAGGGGG - Intronic
1148847740 17:50539061-50539083 GCTGAGAGGTTAGGAGCAGCAGG - Intronic
1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG + Intergenic
1157151917 18:45226904-45226926 GTCCGGAGGTGGGCAGCAGCTGG + Intronic
1159795323 18:72836164-72836186 GCTCAGAGGTGAGAAGCAGCAGG - Intronic
1160073245 18:75647152-75647174 GCCCCTAGGTGAGCATCAACAGG + Intergenic
1160369955 18:78363703-78363725 GCCCCGGGGTCGGCCGCAGCTGG - Intergenic
1160915209 19:1493104-1493126 CCCCCAAGATTAGCAGCAGATGG - Intronic
1161200601 19:3012693-3012715 GCTCTGAGGAAAGCAGCAGCTGG + Intronic
1161501671 19:4619644-4619666 GCCCAGAGGTTGGCAGCCCCGGG - Intergenic
925761454 2:7188463-7188485 GGCCCAAGGTGAGCAACAGCAGG - Intergenic
927941271 2:27104315-27104337 GACCCGTGGGGAGCAGCAGCAGG + Exonic
931051538 2:58420326-58420348 GCTCAGAGGTTAGCAACTGCAGG - Intergenic
931984739 2:67730657-67730679 ACCCCAAGGCTAACAGCAGCAGG + Intergenic
937257350 2:120564828-120564850 TCCCTGAGCTCAGCAGCAGCTGG - Intergenic
938471664 2:131568677-131568699 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
941051244 2:160736413-160736435 ACCCAGAGATTAGCAACAGCAGG - Intergenic
941418444 2:165251669-165251691 ACCCCAAGGCTAGCAGCAGCAGG - Intronic
945932685 2:215871235-215871257 ACCCCGGGATTAGCAACAGCAGG - Intergenic
946404520 2:219485182-219485204 GCCCCGAGGGTGGAATCAGCAGG + Intronic
1168827330 20:822782-822804 GCCCCAAAGTGAGCACCAGCTGG + Intergenic
1169251770 20:4066700-4066722 ACCCAGAGATTAGCAACAGCAGG + Intergenic
1172364001 20:34334962-34334984 GCCCTGAGTTCAGTAGCAGCTGG + Intergenic
1172731927 20:37095758-37095780 GCCTAGAGGTGAGCGGCAGCAGG - Exonic
1173198288 20:40934120-40934142 GCCCTGAGGTAAGAAGGAGCAGG + Intergenic
1176071068 20:63226668-63226690 GCCCGGAGGTGAGCAGGACCTGG + Intergenic
1177131537 21:17262159-17262181 GCCCTGAGATTATCAGCACCTGG + Intergenic
1177911295 21:27035962-27035984 GCCCTGAGGCAAGCAGCAGAAGG - Intergenic
1178840907 21:36136663-36136685 GCGCCCAGGTTTGCAGCTGCTGG - Intronic
1180470272 22:15647713-15647735 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1180472169 22:15668556-15668578 ACCCAGAGATTAGCAGCAGCAGG - Intergenic
1181171934 22:21014842-21014864 GGCCTGAGGGCAGCAGCAGCAGG - Intronic
1181550004 22:23632460-23632482 GCCACAAGGTGGGCAGCAGCAGG - Intergenic
1181798380 22:25327076-25327098 GCCACAAGGTGGGCAGCAGCTGG + Intergenic
1182310602 22:29402882-29402904 GCCACAAGGTGGGCAGCAGCAGG + Intronic
1182690448 22:32157864-32157886 GCCACAAGGTGGGCAGCAGCAGG - Intronic
1182690680 22:32159442-32159464 GCCACAAGGTGGGCAGCAGCAGG - Intergenic
1183105123 22:35610107-35610129 CCCCCGAGGGTAGAAACAGCAGG - Intronic
1184953440 22:47862600-47862622 GCCAAGAGGTCAGCAGCAGGGGG - Intergenic
1185294135 22:50045148-50045170 GTCCTGAGGGTTGCAGCAGCCGG - Intronic
1185344631 22:50305900-50305922 GCCCCAAGGTTGGCCCCAGCAGG - Intronic
1185398065 22:50602607-50602629 GCCCTGAGGTTAGCAGAGCCAGG + Intronic
951676688 3:25249833-25249855 GCCCCAGTGGTAGCAGCAGCAGG + Intronic
951980746 3:28563990-28564012 ACCCAGAGGTTAGCAAGAGCAGG + Intergenic
952305016 3:32137921-32137943 GCTCGGAGATTAGCAACAGCAGG + Intronic
953634280 3:44648995-44649017 GGCCCCAGGTGGGCAGCAGCCGG - Intronic
954671847 3:52295291-52295313 GGCACGAGGGCAGCAGCAGCCGG - Intergenic
954792463 3:53143358-53143380 GCCCAGAGGGTAGCACCAGCAGG - Intergenic
961591557 3:127985255-127985277 GCCATGGGGTTGGCAGCAGCTGG - Exonic
962316950 3:134364929-134364951 GCCCTGAGCTCAGCAGCAGGAGG - Intronic
967133356 3:186492910-186492932 GCCCCGAGGGCAGCAGCTGTGGG - Intergenic
969327467 4:6452205-6452227 GCCCCCAGGCTAGCAGGAGGTGG - Intronic
981128480 4:141132904-141132926 GCCCGGGAGTGAGCAGCAGCAGG - Intronic
982737513 4:159021441-159021463 GCTCCTGGGTGAGCAGCAGCTGG + Intronic
983034056 4:162840194-162840216 ACCCAGAGTCTAGCAGCAGCAGG - Intergenic
988448497 5:31315013-31315035 GCCCCGAGGTGAGTGGGAGCTGG - Intronic
992632074 5:78691232-78691254 GCCAGCAGGTAAGCAGCAGCTGG - Intronic
995760122 5:115553701-115553723 CCCTCCAGGTTAGCAGAAGCTGG - Intergenic
996056449 5:118988281-118988303 GCCCCGCGGTCACCTGCAGCGGG + Exonic
999367960 5:151035158-151035180 GCCCAGAGGGAAGCATCAGCCGG - Intronic
1002929530 6:1623991-1624013 CCGCCGAGGTTTGTAGCAGCCGG - Exonic
1003180848 6:3790070-3790092 GCCCGGAGGTTAGTTGCTGCAGG - Intergenic
1004822256 6:19380330-19380352 GCCCAGGGATTAGCAGTAGCTGG + Intergenic
1016017242 6:139198835-139198857 TCCCTGGGGTTAGCAGCAGTGGG - Intergenic
1019037505 6:169073757-169073779 GCACCGAGGTTTGCAGCCGTAGG - Intergenic
1026024237 7:66732229-66732251 GCCCCATGGCTAGCTGCAGCTGG - Intronic
1028121295 7:87059310-87059332 GCCAGGAGGTGAGCAGCACCTGG - Exonic
1032719953 7:134542679-134542701 GCAACTAGTTTAGCAGCAGCAGG - Intergenic
1032724853 7:134581095-134581117 GCAACTAGTTTAGCAGCAGCAGG - Intergenic
1035113803 7:156506141-156506163 GCCCCTCGGGTAGCAGCAGCAGG + Intergenic
1035464270 7:159064571-159064593 GCTTCGAGGTTGTCAGCAGCAGG + Intronic
1039831720 8:41220828-41220850 GCCGCGAGGCAAGCAGCAGCAGG - Intergenic
1041198325 8:55424118-55424140 GCCCCGAGGTGATCTGAAGCAGG - Intronic
1045856419 8:106770082-106770104 GGCCCGAGGTTGGCAGCAGTGGG - Exonic
1045955276 8:107898515-107898537 ACCCAGAGATTAGCAACAGCAGG - Intergenic
1046023524 8:108695109-108695131 GCCAAGAGGTCAGCACCAGCTGG + Intronic
1049179824 8:141216509-141216531 GCCTCTTGGTCAGCAGCAGCCGG - Intronic
1049346575 8:142142447-142142469 GTCCTGAGGCTAGCAGCAGCTGG + Intergenic
1049801824 8:144521391-144521413 GGCCTGAGGCTAGAAGCAGCTGG - Exonic
1051084360 9:13330823-13330845 CACCCTAGGTTAGCAACAGCAGG - Intergenic
1051626215 9:19102356-19102378 GCCCCTAGGCTGGCAGCAACTGG + Intronic
1053917400 9:42953871-42953893 GCCCTGGGGTTAGCATCATCTGG + Intergenic
1057378830 9:94550278-94550300 GTCCAGGGATTAGCAGCAGCAGG + Intergenic
1057896969 9:98916889-98916911 CCCGCGTGGTCAGCAGCAGCTGG - Intergenic
1059573506 9:115466140-115466162 GCCTGGGGGTTAGCAGTAGCAGG + Intergenic
1061639356 9:131939807-131939829 GCCCGGAGGTGCGCAACAGCAGG - Intronic
1187455796 X:19440201-19440223 GCCCTGAAGTTAGCATCAGCAGG - Intronic
1192167395 X:68834543-68834565 CCCCCGAGGCTGGCAGGAGCAGG - Intronic
1195098854 X:101533356-101533378 ACCCAGAGGTTAGCAATAGCAGG - Intronic
1197198927 X:123732428-123732450 GCCCCGGGCTTCGCGGCAGCGGG + Intronic
1197758619 X:130013158-130013180 GCGCCGAGGCCAGCAACAGCAGG + Exonic
1197773601 X:130106212-130106234 GACTGGAGGTCAGCAGCAGCTGG - Intronic
1199676026 X:150190036-150190058 GTCAGGAGGTTAGCAGCAGTGGG - Intergenic